CD24 (NM_001291737) Human Untagged Clone

CAT#: SC333399

CD24 (untagged) - Human CD24 molecule (CD24), transcript variant 2



  "NM_001291737" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CD24 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD24A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333399 representing NM_001291737.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCAGAGCAATGGTGGCCAGGCTCGGGCTGGGGCTGCTGCTGCTGGCACTGCTCCTACCCACGCAG
ATTTATTCCAGTGAAACAACAACTGGAACTTCAAGTAACTCCTCCCAGAGTACTTCCAACTCTGGGTTG
GCCCCAAATCCAACTAATGCCACCACCAAGGCGGCTGGTGGTGCCCTGCAGTCAACAGCCAGTCTCTTC
GTGGTCTCACTCTCTCTTCTGCATCTCTACTCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001291737
Insert Size 243 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291737.1
RefSeq Size 2440 bp
RefSeq ORF 243 bp
Locus ID 100133941
UniProt ID P25063
MW 8.1 kDa
Gene Summary This gene encodes a sialoglycoprotein that is expressed on mature granulocytes and B cells and modulates growth and differentiation signals to these cells. The precursor protein is cleaved to a short 32 amino acid mature peptide which is anchored via a glycosyl phosphatidylinositol (GPI) link to the cell surface. This gene was missing from previous genome assemblies, but is properly located on chromosome 6. Non-transcribed pseudogenes have been designated on chromosomes 1, 15, 20, and Y. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3 and 7 encode isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...