KLRF1 (NM_001291823) Human Untagged Clone
CAT#: SC333336
KLRF1 (untagged) - Human killer cell lectin-like receptor subfamily F, member 1 (KLRF1), transcript variant KLRF1-s3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CLEC5C; NKp80 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333336 representing NM_001291823.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAAGATGAAGAAAGATACATGACATTGAATGTACAGTCAAAGAAAAGGAGTTCTGCCCAAACATCT CAACTTACATTTAAAGATTATTCAGTGACGTTGCACTGGTATAAAATCTTACTGGGAATATCTGGAACC GTGAATGGTATTCTCACTTTGACTTTGATCTCCTTGATCCTGTTGGATTCTTCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291823 |
Insert Size | 195 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291823.1 |
RefSeq Size | 863 bp |
RefSeq ORF | 195 bp |
Locus ID | 51348 |
UniProt ID | Q9NZS2 |
Protein Families | Transmembrane |
MW | 7.3 kDa |
Gene Summary | KLRF1, an activating homodimeric C-type lectin-like receptor (CTLR), is expressed on nearly all natural killer (NK) cells and stimulates their cytoxicity and cytokine release (Kuttruff et al., 2009 [PubMed 18922855]).[supplied by OMIM, Oct 2009] Transcript Variant: This variant (KLRF1-s3) lacks three alternate coding exons that result in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (KLRF1-s3) has a distinct C-terminus and is significantly shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235442 | KLRF1 (myc-DDK-tagged) - Human killer cell lectin-like receptor subfamily F, member 1 (KLRF1), transcript variant KLRF1-s3 |
CNY 3,990.00 |
|
RG235442 | KLRF1 (tGFP-tagged) - Human killer cell lectin-like receptor subfamily F, member 1 (KLRF1), transcript variant KLRF1-s3 |
CNY 4,370.00 |