APELA (NM_001297550) Human Untagged Clone
CAT#: SC333312
APELA (untagged) - Human apelin receptor early endogenous ligand (APELA)
CNY 1,320.00
CNY 2,950.00
货期*
现货
规格
Product images
经常一起买 (3)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ELA; Ende; tdl |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001297550, the custom clone sequence may differ by one or more nucleotides
ATGAGATTTCAGCAATTCCTTTTTGCATTTTTTATTTTTATTATGAGTCTTCTCCTTATCAGCGGACAGA GACCAGTTAATTTGACCATGAGAAGAAAACTGCGCAAACACAATTGCCTTCAGAGGAGATGTATGCCTCT CCATTCACGAGTACCCTTTCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001297550 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001297550.1, NP_001284479.1 |
RefSeq Size | 2622 bp |
RefSeq ORF | 165 bp |
Locus ID | 100506013 |
UniProt ID | P0DMC3 |
Gene Summary | This gene encodes a peptide hormone that binds to the Apelin receptor. The encoded protein is required for heart development in zebrafish and has been shown to maintain self-renewal of human embryonic stem cells through activation of the PI3K/AKT pathway. Experiments in human and mouse cell lines point to additional roles for the encoded protein in angiogenesis and regulation of vascular tone. [provided by RefSeq, Jul 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...