SLC22A12 (NM_153378) Human Untagged Clone

CAT#: SC333303

SLC22A12 (untagged) - Homo sapiens solute carrier family 22 (organic anion/urate transporter), member 12 (SLC22A12), transcript variant 2



  "NM_153378" in other vectors (3)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SLC22A12 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms OAT4L; RST; URAT1
Vector pCMV6-Entry
Sequence Data
>SC333303 representing NM_153378.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGTGGACGGCGGCACGGGCCCGACCCTTGGTGATGACCTTGAACTCTCTGGGCTTCAGCTTCGGC
CATGGCCTGACAGCTGCAGTGGCCTACGGTGTGCGGGACTGGACACTGCTGCAGCTGGTGGTCTCGGTC
CCCTTCTTCCTCTGCTTTTTGTACTCCTGGTGGCTGGCAGAGTCGGCACGATGGCTCCTCACCACAGGC
AGGCTGGATTGGGGCCTGCAGGAGCTGTGGAGGGTGGCTGCCATCAACGGAAAGGGGGCAGTGCAGGAC
ACCCTGACCCCTGAGGTCTTGCTTTCAGCCATGCGGGAGGAGCTGAGCATGGGCCAGCCTCCTGCCAGC
CTGGGCACCCTGCTCCGCATGCCCGGACTGCGCTTCCGGACCTGTATCTCCACGTTGTGCTGGTTCGCC
TTTGGCTTCACCTTCTTCGGCCTGGCCCTGGACCTGCAGGCCCTGGGCAGCAACATCTTCCTGCTCCAA
ATGTTCATTGGTGTCGTGGACATCCCAGCCAAGATGGGCGCCCTGCTGCTGCTGAGCCACCTGGGCCGC
CGCCCCACGCTGGCCGCATCCCTGTTGCTGGCAGGGCTCTGCATTCTGGCCAACACGCTGGTGCCCCAC
GAAATGGGGGCTCTGCGCTCAGCCTTGGCCGTGCTGGGGCTGGGCGGGGTGGGGGCTGCCTTCACCTGC
ATCACCATCTACAGCAGCGAGCTCTTCCCCACTGTGCTCAGGATGACGGCAGTGGGCTTGGGCCAGATG
GCAGCCCGTGGAGGAGCCATCCTGGGGCCTCTGGTCCGGCTGCTGGGTGTCCATGGCCCCTGGCTGCCC
TTGCTGGTGTATGGGACGGTGCCAGTGCTGAGTGGCCTGGCCGCACTGCTTCTGCCCGAGACCCAGAGC
TTGCCGCTGCCCGACACCATCCAAGATGTGCAGAACCAGGCAGTAAAGAAGGCAACACATGGCACGCTG
GGGAACTCTGTCCTAAAATCCACACAGTTTTAG

Restriction Sites SgfI-MluI     
ACCN NM_153378
Insert Size 999 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153378.2
RefSeq Size 2960 bp
RefSeq ORF 999 bp
Locus ID 116085
UniProt ID Q96S37
Protein Families Transmembrane
MW 35.6 kDa
Gene Summary The protein encoded by this gene is a member of the organic anion transporter (OAT) family, and it acts as a urate transporter to regulate urate levels in blood. This protein is an integral membrane protein primarily found in epithelial cells of the proximal tubule of the kidney. An elevated level of serum urate, hyperuricemia, is associated with increased incidences of gout, and mutations in this gene cause renal hypouricemia type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) contains alternate 5' exon structure, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...