IFTAP (NM_001276722) Human Untagged Clone
CAT#: SC333265
C11orf74 (untagged) - Homo sapiens chromosome 11 open reading frame 74 (C11orf74), transcript variant 1
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C11orf74; HEPIS; NWC |
Vector | pCMV6-Entry |
Sequence Data |
>SC333265 representing NM_001276722.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCTGCCCATATGTCAGGATTGGAAATAATGGATGAAGATCAATTAATCAAAGACGTCTTGGATAAA TTCCTTAATTGTCATGAGCAAACATATGATGAAGAATTTCTGAACACTTTTACTCATCTTTCACAAGAG GATCATGTGTCCAAAAGGGGAGTGTTTGGAACTGATTCTTCAGAAAACATTTTTACCTCAGCAAAAGTT ACTCATAAAAATGAAGCAGATGACTACCATCTTAGAAATAAAACCATCTTTCTTCGTACTTCATCACAA TGTTTGGAAGAACAGGTAGATAATTTCCTAGATTTAGAAGATTTGGACATGGATGAAGAGATTAAACCC CAAATGAGTGAGGATTTGCTGCTGCTTCCAGGAGAAGTGGAGCAGGATGTAAGCACCAGCATTCCTTCC TGTATCCCTTTTGTGGCCCAGCCTCCTACCTGTGAAGTGAAGCCAAAGCCCAGTGTTAAAAGAATGGAC AAACAGACGGAAGAGATACTTGGAGATGAAGTTCAACTTTTTTCACTTGATGAAGAATTTGATTATGAC AATGTGATGCTAACCTCCAAGTTTAGTCCTGCAGAGATAGAGAACATCAAAGAGCTATGCAAGCAGCAG AAGAGAAAGGACACCAGCCCAGACTTAGAGAAATCCTGTGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001276722 |
Insert Size | 666 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001276722.1 |
RefSeq Size | 1080 bp |
RefSeq ORF | 666 bp |
Locus ID | 119710 |
UniProt ID | Q86VG3 |
MW | 25.4 kDa |
Gene Summary | This gene encodes a protein that was identified as a cellular interacting partner of non-structural protein 10 of the severe acute respiratory syndrome coronavirus (SARS-CoV). The encoded protein may function as a negative regulator of transcription. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variants 1, 2, 3, and 4 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233477 | C11orf74 (Myc-DDK tagged) - Homo sapiens chromosome 11 open reading frame 74 (C11orf74), transcript variant 1 |
CNY 2,400.00 |
|
RG233477 | C11orf74 (tGFP-tagged) - Homo sapiens chromosome 11 open reading frame 74 (C11orf74), transcript variant 1 |
CNY 4,370.00 |