Cardiac Troponin T (TNNT2) (NM_001276347) Human Untagged Clone

CAT#: SC333246

TNNT2 (untagged) - Homo sapiens troponin T type 2 (cardiac) (TNNT2), transcript variant 7



  "NM_001276347" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TNNT2 mouse monoclonal antibody, clone OTI3H2 (formerly 3H2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMD1D; CMH2; CMPD2; cTnT; LVNC6; RCM3; TnTC
Vector pCMV6-Entry
Sequence Data
>SC333246 representing NM_001276347.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTGACATAGAAGAGGTGGTGGAAGAGTACGAGGAGGAGGAGCAGGAAGAAGCAGCTGTTGAAGAG
CAGGAGGAGGCAGCGGAAGAGGATGCTGAAGCAGAGGCTGAGACCGAGGAGACCAGGGCAGAAGAAGAT
GAAGAAGAAGAGGAAGCAAAGGAGGCTGAAGATGGCCCAATGGAGGAGTCCAAACCAAAGCCCAGGTCG
TTCATGCCCAACTTGGTGCCTCCCAAGATCCCCGATGGAGAGAGAGTGGACTTTGATGACATCCACCGG
AAGCGCATGGAGAAGGACCTGAATGAGTTGCAGGCGCTGATCGAGGCTCACTTTGAGAACAGGAAGAAA
GAGGAGGAGGAGCTCGTTTCTCTCAAAGACAGGATCGAGAGACGTCGGGCAGAGCGGGCCGAGCAGCAG
CGCATCCGGAATGAGCGGGAGAAGGAGCGGCAGAACCGCCTGGCTGAAGAGAGGGCTCGACGAGAGGAG
GAGGAGAACAGGAGGAAGGCTGAGGATGAGGCCCGGAAGAAGAAGGCTTTGTCCAACATGATGCATTTT
GGGGGTTACATCCAGAAGCAGGCCCAGACAGAGCGGAAAAGTGGGAAGAGGCAGACTGAGCGGGAAAAG
AAGAAGAAGATTCTGGCTGAGAGGAGGAAGGTGCTGGCCATTGACCACCTGAATGAAGATCAGCTGAGG
GAGAAGGCCAAGGAGCTGTGGCAGAGCATCTATAACTTGGAGGCAGAGAAGTTCGACCTGCAGGAGAAG
TTCAAGCAGCAGAAATATGAGATCAATGTTCTCCGAAACAGGATCAACGATAACCAGAAAGTCTCCAAG
ACCCGCGGGAAGGCTAAAGTCACCGGGCGCTGGAAATAG

Restriction Sites SgfI-MluI     
ACCN NM_001276347
Insert Size 867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001276347.1
RefSeq Size 1307 bp
RefSeq ORF 867 bp
Locus ID 7139
UniProt ID P45379
Protein Families Druggable Genome
Protein Pathways Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM)
MW 34.6 kDa
Gene Summary The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (7) differs in the 5' UTR and lacks an in-frame exon in the 5' coding region compared to variant 5. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 5. Variants 2 and 7 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...