HERPUD1 (NM_001272103) Human Untagged Clone
CAT#: SC333212
HERPUD1 (untagged) - Homo sapiens homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 (HERPUD1), transcript variant 4
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HERP; Mif1; SUP |
Vector | pCMV6-Entry |
Sequence Data |
>SC333212 representing NM_001272103.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAGTCCGAGACCGAACCCGAGCCCGTCACGCTCCTGGTGAAGAGCCCCAACCAGCGCCACCGCGAC TTGGAGCTGAGTGGCGACCGCGGCTGGAGTGTGGGCCACCTCAAGGCCCACCTGAGCCGCGTCTACCCC GAGCGTCCGCGTCCAGAGGACCAGAGGTTAATTTATTCTGGGAAGCTGTTGTTGGATCACCAATGTCTC AGGGACTTGCTTCCAAAGCAGGAAAAACGGCATGTTTTGCATCTGGTGTGCAATGTGAAGAGTCCTTCA AAAATGCCAGAAATCAACGCCAAGGTGGCTGAATCCACAGAGGAGCCTGCTGGTTCTAATCGGGGACAG TATCCTGAGGATTCCTCAAGTGATGGTTTAAGGCAAAGGGAAGTTCTTCGGAACCTTTCTTCCCCTGGA TGGGAAAACATCTCAAGGCCTGAAGCTGCCCAGCAGGCATTCCAAGGCCTGGGTCCTGGTTTCTCCGGT TACACACCCTATGGGTGGCTTCAGCTTTCCTGGTTCCAGCAGATATATGCACGACAGTACTACATGCAA TATTTAGCAGCCACTGCTGCATCAGGGGCTTTTGTTCCACCACCAAGTGCACAAGAGATACCTGTGGTC TCTGCACCTGCTCCAGCCCCTATTCACAACCAGTTTCCAGCTGAAAACCAGCCTGCCAATCAGAATGCT GCTCCTCAAGTGGTTGTTAATCCTGGAGCCAATCAAAATTTGCGGATGAATGCACAAGGCATCACGTTG GGTGGTTTCCATTTAGACCGAGGCCGGTTCAGAACTTCCCAAATGATGGTCCTCCTCCTGACGTTGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001272103 |
Insert Size | 828 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001272103.1 |
RefSeq Size | 1787 bp |
RefSeq ORF | 828 bp |
Locus ID | 9709 |
UniProt ID | Q15011 |
Protein Families | Druggable Genome |
MW | 30.6 kDa |
Gene Summary | The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (4) uses an alternate splice site in the 3' coding region compared to variant 1, that causes a frameshift. The resulting isoform (4) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233619 | HERPUD1 (Myc-DDK tagged) - Homo sapiens homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 (HERPUD1), transcript variant 4 |
CNY 3,990.00 |
|
RG233619 | HERPUD1 (tGFP-tagged) - Homo sapiens homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 (HERPUD1), transcript variant 4 |
CNY 4,370.00 |
其它HERPUD1产品