SLC39A1 (NM_001271961) Human Untagged Clone
CAT#: SC333169
SLC39A1 (untagged) - Homo sapiens solute carrier family 39 (zinc transporter), member 1 (SLC39A1), transcript variant 6
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ZIP1; ZIRTL |
Vector | pCMV6-Entry |
Sequence Data |
>SC333169 representing NM_001271961.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGGCCCTGGGGAGAGCCAGAGCTCCTGGTGTGGCGCCCCGAGGCGGTAGCTTCAGAGCCTCCAGTG CCTGTGGGGCTGGAGGTGAAGTTGGGGGCCCTGGTGCTGCTGCTGGTGCTCACCCTCCTCTGCAGCCTG GTGCCCATCTGTGTGCTGCGCCGGCCAGGAGCTAACCATGAAGGCTCAGCTCCAGTTCCCACTGCAAGA GTTCATCCTGGCCATGGGCTTCTTCCTGGTCCTGGTGATGGAGCAGATCACACTGGCTTACAAGGAGCA GTCAGGGCCGTCACCTCTGGAGGAAACAAGGGCTCTGCTGGGAACAGTGAATGGTGGGCCGCAGCATTG GCATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271961 |
Insert Size | 351 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001271961.1 |
RefSeq Size | 2024 bp |
RefSeq ORF | 351 bp |
Locus ID | 27173 |
UniProt ID | Q9NY26 |
Protein Families | Transmembrane |
MW | 11.8 kDa |
Gene Summary | This gene encodes a member of the zinc-iron permease family. The encoded protein is localized to the cell membrane and acts as a zinc uptake transporter. This gene has been linked to prostate cancer, breast cancer, and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (6) differs in the 5' UTR and lacks an exon in the 3' coding region which results in a frameshift, compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233277 | SLC39A1 (Myc-DDK tagged) - Homo sapiens solute carrier family 39 (zinc transporter), member 1 (SLC39A1), transcript variant 6 |
CNY 3,990.00 |
|
RG233277 | SLC39A1 (tGFP-tagged) - Homo sapiens solute carrier family 39 (zinc transporter), member 1 (SLC39A1), transcript variant 6 |
CNY 4,370.00 |
其它SLC39A1产品