SLC39A1 (NM_001271961) Human Untagged Clone

CAT#: SC333169

SLC39A1 (untagged) - Homo sapiens solute carrier family 39 (zinc transporter), member 1 (SLC39A1), transcript variant 6



  "NM_001271961" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal ZIP1 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ZIP1; ZIRTL
Vector pCMV6-Entry
Sequence Data
>SC333169 representing NM_001271961.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGCCCTGGGGAGAGCCAGAGCTCCTGGTGTGGCGCCCCGAGGCGGTAGCTTCAGAGCCTCCAGTG
CCTGTGGGGCTGGAGGTGAAGTTGGGGGCCCTGGTGCTGCTGCTGGTGCTCACCCTCCTCTGCAGCCTG
GTGCCCATCTGTGTGCTGCGCCGGCCAGGAGCTAACCATGAAGGCTCAGCTCCAGTTCCCACTGCAAGA
GTTCATCCTGGCCATGGGCTTCTTCCTGGTCCTGGTGATGGAGCAGATCACACTGGCTTACAAGGAGCA
GTCAGGGCCGTCACCTCTGGAGGAAACAAGGGCTCTGCTGGGAACAGTGAATGGTGGGCCGCAGCATTG
GCATGA

Restriction Sites SgfI-MluI     
ACCN NM_001271961
Insert Size 351 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271961.1
RefSeq Size 2024 bp
RefSeq ORF 351 bp
Locus ID 27173
UniProt ID Q9NY26
Protein Families Transmembrane
MW 11.8 kDa
Gene Summary This gene encodes a member of the zinc-iron permease family. The encoded protein is localized to the cell membrane and acts as a zinc uptake transporter. This gene has been linked to prostate cancer, breast cancer, and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (6) differs in the 5' UTR and lacks an exon in the 3' coding region which results in a frameshift, compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...