TWIST2 (NM_001271893) Human Untagged Clone
CAT#: SC333148
TWIST2 (untagged) - Homo sapiens twist family bHLH transcription factor 2 (TWIST2), transcript variant 1
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AMS; BBRSAY; bHLHa39; DERMO1; FFDD3; SETLSS |
Vector | pCMV6-Entry |
Sequence Data |
>SC333148 representing NM_001271893.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAGGAGGGCTCCAGCTCGCCCGTGTCCCCCGTGGACAGCCTGGGCACCAGCGAGGAGGAGCTCGAG AGGCAGCCCAAGCGCTTCGGCCGGAAGCGGCGCTACAGCAAGAAGTCGAGCGAAGATGGCAGCCCGACC CCGGGCAAGCGCGGCAAGAAGGGCAGCCCCAGCGCGCAGTCCTTCGAGGAGCTGCAGAGCCAGCGCATC CTGGCCAACGTGCGCGAGCGCCAGCGCACCCAGTCGCTCAACGAGGCCTTCGCGGCGCTGCGCAAGATC ATCCCCACGCTGCCCTCTGACAAGCTGAGCAAGATCCAGACGCTCAAGCTGGCCGCCAGGTACATAGAC TTCCTCTACCAGGTCCTGCAGAGCGACGAGATGGACAATAAGATGACCAGCTGCAGCTACGTGGCCCAC GAGCGCCTCAGCTACGCCTTCTCCGTGTGGCGCATGGAGGGCGCGTGGTCCATGTCCGCCTCCCACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271893 |
Insert Size | 483 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271893.2 |
RefSeq Size | 1434 bp |
RefSeq ORF | 483 bp |
Locus ID | 117581 |
UniProt ID | Q8WVJ9 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 18.1 kDa |
Gene Summary | The protein encoded by this gene is a basic helix-loop-helix type transcription factor and shares similarity with Twist. This protein may inhibit osteoblast maturation and maintain cells in a preosteoblast phenotype during osteoblast development. This gene may be upregulated in certain cancers. Mutations in this gene cause focal facial dermal dysplasia 3, Setleis type. Two transcript variants encoding the same protein have been found. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233329 | TWIST2 (Myc-DDK tagged) - Homo sapiens twist family bHLH transcription factor 2 (TWIST2), transcript variant 1 |
CNY 1,200.00 |
|
RG233329 | TWIST2 (tGFP-tagged) - Homo sapiens twist family bHLH transcription factor 2 (TWIST2), transcript variant 1 |
CNY 4,370.00 |