Casein Kinase 1 alpha (CSNK1A1) (NM_001271741) Human Untagged Clone

CAT#: SC333098

CSNK1A1 (untagged) - Homo sapiens casein kinase 1, alpha 1 (CSNK1A1), transcript variant 3



  "NM_001271741" in other vectors (2)

CNY 3,140.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-CSNK1A1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CK1; CK1a; CKIa; HEL-S-77p; HLCDGP1; PRO2975
Vector pCMV6-Entry
Sequence Data
>SC333098 representing NM_001271741.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGAGTAGCAGCGGCTCCAAGGCTGAATTCATTGTCGGAGGGAAATATAAACTGGTACGGAAGATC
GGGTCTGGCTCCTTCGGGGACATCTATTTGGCGATCAACATCACCAACGGCGAGGAAGTGGCAGTGAAG
CTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAGCTCTATAAGATTCTTCAAGGT
GGGGTTGGCATCCCCCACATACGGTGGTATGGTCAGGAAAAAGACTACAATGTACTAGTCATGGATCTT
CTGGGACCTAGCCTCGAAGACCTCTTCAATTTCTGTTCAAGAAGGTTCACAATGAAAACTGTACTTATG
TTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAA
CCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCC
AAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAACCTCACTGGCACT
GCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAGCAGAGTCGCCGAGATGACATGGAATCATTA
GGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCATGGCAAGGGCTAAAGGCTGCAACAAAGAAA
CAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACGCCTGTTGAAGTTTTATGTAAGGGGTTTCCT
GCAGAATTTGCGATGTACTTAAACTATTGTCGTGGGCTACGCTTTGAGGAAGCCCCAGATTACATGTAT
CTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCATCAATATGACTACACATTTGATTGGACA
ATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCCAGTGGGCAGGGTCAGCAGGCCCAAACCCCC
ACAGGTTTCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001271741
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271741.1
RefSeq Size 2541 bp
RefSeq ORF 978 bp
Locus ID 1452
UniProt ID P48729
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase
Protein Pathways Hedgehog signaling pathway, Wnt signaling pathway
MW 37.6 kDa
Gene Summary Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. It can phosphorylate a large number of proteins. Participates in Wnt signaling. Phosphorylates CTNNB1 at 'Ser-45'. May phosphorylate PER1 and PER2. May play a role in segregating chromosomes during mitosis (PubMed:11955436, PubMed:1409656, PubMed:18305108). May play a role in keratin cytoskeleton disassembly and thereby, it may regulate epithelial cell migration (PubMed:23902688).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an in-frame internal exon and uses an alternate splice site, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...