TINP1 (NSA2) (NM_001271665) Human Untagged Clone

CAT#: SC333079

NSA2 (untagged) - Homo sapiens NSA2 ribosome biogenesis homolog (S. cerevisiae) (NSA2), transcript variant 2



  "NM_001271665" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Chicken Polyclonal TINP1 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDK105; HCL-G1; HCLG1; HUSSY-29; HUSSY29; TINP1
Vector pCMV6-Entry
Sequence Data
>SC333079 representing NM_001271665.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCACAGAATGAATATATTGAATTACACCGTAAACGCTATGGATACCGTTTGGATTACCATGAGAAA
AAGAGAAAGAAGGAAAGTCGAGAGGCTCATGAACGTTCAAAGAAGGCAAAGAAAATGATTGGTCTGAAG
GCTAAGCTTTACCATAAACAGCGTCATGCTGAGAAAATACAAATGAAAAAGACTATCAAGATGCATGAA
AAGAGAAACACCAAACAAAAGAATGATGAAAAGACACCACAGGGAGCAGTACCTGCCTATCTGCTGGAC
AGAGAGGGACAATCTCGAGCTAAAGTACTTTCCAATATGATTAAACAGAAAAGAAAAGAGAAGGCGGGA
AAATGGGAAGTCCCTCTGCCTAAAGTACGTGCCCAGGGAGAAACAGAAGTATTAAAAGTTATTCGAACA
GGAAAGAGAAAGAAGAAGGCATGGAAGAGAATGGTTACTAAAGTGTGCTTTGTTGGAGATGGCTTTACA
AGAAAACCACCTAAATATGAAAGATTCATCAGGCCAATGGAAAATATGCCCAGGTTACCAACAATCCTG
AAAATGATGGATGTATAA

Restriction Sites SgfI-MluI     
ACCN NM_001271665
Insert Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271665.1
RefSeq Size 1208 bp
RefSeq ORF 570 bp
Locus ID 10412
UniProt ID O95478
MW 22.7 kDa
Gene Summary This gene encodes a nucleolar protein involved in cell cycle regulation and proliferation. This gene was identified based on sequence similarity to a highly conserved Saccharomyces cerevisiae gene encoding a pre-ribosomal protein, which is involved in large ribosomal subunit biogenesis. The encoded protein is found at elevated levels in diabetic nephropathy. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...