STX10 (NM_001271610) Human Untagged Clone

CAT#: SC333071

STX10 (untagged) - Homo sapiens syntaxin 10 (STX10), transcript variant 3



  "NM_001271610" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-STX10 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hsyn10; SYN10
Vector pCMV6-Entry
Sequence Data
>SC333071 representing NM_001271610.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTCTCGAAGACCCCTTTTTTGTAGTCCGAGGCGAGGTGCAGAAGGCGGTGAACACGGCCCGCGGG
CTGTACCAGCGCTGGTGCGAGCTCCTGCAGGAAAGCGCGGCGGTCGGACGCGAGGAGCTGGACTGGACG
ACCAATGAGCTGCGGAATGGCCTGCGCAGCATCGAGTGGGACCTCGAGGACCTGGAAGAGACCATCGGT
ATAGTGGAAGCCAACCCAGGCAAGTTCAAGCTCCCAGCCGGGGACCTGCAGGAGAGAAAGGTGTTCGTG
GAGCGGATGCGAGAGGCAGTCCAGGAAATGAAGGACCATATGGTCAGCCCAACAGCCGTAGCATTTTTG
GAGAGGAATAACAGAGAGATACTCGCAGGCAAGCCAGCTGCCCAGAAGTCACCCAGCGACCTGCTGGAT
GCCAGCGCAGTCTCGGCCACATCTCGCTACATCGAGGAGCAGCAGGCCACACAGCAGCTGATCATGGAT
GAACAGGATCAACAGCTGGAGATGGTGTCTGGGAGCATCCAGGTTCTGAAGCACATGTCCGGCCGCGTT
GGAGAAGAGCTGGACGAGCAGGGCATCATGCTGGATGCCTTCGCCCAAGAGATGGACCACACCCAGTCC
CGCATGGACGGGGTCCTCAGGAAGTTGGCCAAAGTATCCCACATGACGAGTGGTGAGTCCCCTCAGGGG
AGGGGTCAGTCCTGGTGGGGGCAGGTTGTAGGTGGTACCCTCTCCCCGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271610
Insert Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271610.1
RefSeq Size 1410 bp
RefSeq ORF 741 bp
Locus ID 8677
Protein Families Druggable Genome, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
MW 27.6 kDa
Gene Summary This gene belongs to the syntaxin family and encodes a soluble N-ethylmaleimide sensitive factor attachment protein receptor (SNARE). The encoded protein is involved in docking and fusion events at the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...