BASP1 (NM_001271606) Human Untagged Clone
CAT#: SC333069
BASP1 (untagged) - Homo sapiens brain abundant, membrane attached signal protein 1 (BASP1), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAP-23; CAP23; NAP-22; NAP22 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333069 representing NM_001271606.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGAGGCAAGCTCAGCAAGAAGAAGAAGGGCTACAATGTGAACGACGAGAAAGCCAAGGAGAAAGAC AAGAAGGCCGAGGGCGCGGCGACGGAAGAGGAGGGGACCCCGAAGGAGAGTGAGCCCCAGGCGGCCGCA GAGCCCGCCGAGGCCAAGGAGGGCAAGGAGAAGCCCGACCAGGACGCCGAGGGCAAGGCCGAGGAGAAG GAGGGCGAGAAGGACGCGGCGGCTGCCAAGGAGGAGGCCCCGAAGGCGGAGCCCGAGAAGACGGAGGGC GCGGCAGAGGCCAAGGCTGAGCCCCCGAAGGCGCCCGAGCAGGAGCAGGCGGCCCCCGGCCCCGCTGCG GGCGGCGAGGCCCCCAAAGCTGCTGAGGCCGCCGCGGCCCCGGCCGAGAGCGCGGCCCCTGCCGCCGGG GAGGAGCCCAGCAAGGAGGAAGGGGAACCCAAAAAGACTGAGGCGCCCGCAGCTCCTGCCGCCCAGGAG ACCAAAAGTGACGGGGCCCCAGCTTCAGACTCAAAACCCGGCAGCTCGGAGGCTGCCCCCTCTTCCAAG GAGACCCCCGCAGCCACGGAAGCGCCTAGTTCCACACCCAAGGCCCAGGGCCCCGCAGCCTCTGCAGAA GAGCCCAAGCCGGTGGAGGCCCCGGCAGCTAATTCCGACCAAACCGTAACCGTGAAAGAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271606 |
Insert Size | 684 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271606.1 |
RefSeq Size | 1727 bp |
RefSeq ORF | 684 bp |
Locus ID | 10409 |
UniProt ID | P80723 |
MW | 22.7 kDa |
Gene Summary | This gene encodes a membrane bound protein with several transient phosphorylation sites and PEST motifs. Conservation of proteins with PEST sequences among different species supports their functional significance. PEST sequences typically occur in proteins with high turnover rates. Immunological characteristics of this protein are species specific. This protein also undergoes N-terminal myristoylation. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2012] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233486 | BASP1 (Myc-DDK tagged) - Homo sapiens brain abundant, membrane attached signal protein 1 (BASP1), transcript variant 2 |
CNY 2,400.00 |
|
RG233486 | BASP1 (tGFP-tagged) - Homo sapiens brain abundant, membrane attached signal protein 1 (BASP1), transcript variant 2 |
CNY 4,370.00 |