MARVELD3 (NM_001271329) Human Untagged Clone

CAT#: SC333051

MARVELD3 (untagged) - Homo sapiens MARVEL domain containing 3 (MARVELD3), transcript variant 3



  "NM_001271329" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MARVELD3 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MARVD3; MRVLDC3
Vector pCMV6-Entry
Sequence Data
>SC333051 representing NM_001271329.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAAGATCCGTCGGGGGCTCGCGAGCCCCGGGCCCGGCCGAGAGAGCGGGACCCGGGACGGCGCCCC
CACCCAGACCAAGGCCGCACCCACGATCGACCGCGGGACCGACCCGGGGACCCGCGCAGGAAGCGAAGC
AGCGACGGGAACCGGCGAAGGGACGGGGACCGGGACCCGGAGAGAGACCAGGAGAGGGACGGGAACCGC
GACCGGAACCGGGACCGGGAGAGGGAGAGAGAGAGGGAAAGAGACCCGGACCGAGGCCCCCGCCGGGAC
ACACACAGGGACGCGGGCCCTCGCGCAGTGAACCCCCTTCGGAGAGATATCTGCCCTCGACCCCCAGGC
CTGGACGAGAGGAGGTGGAATATTACCAGTCAGAGGCGGAAGGACTCCTGGAATGCCACAAATGCAAAT
ACTTGTGCACTGGGAGAGGTGTGGTGCAGATAG

Restriction Sites SgfI-MluI     
ACCN NM_001271329
Insert Size 447 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271329.1
RefSeq Size 2110 bp
RefSeq ORF 447 bp
Locus ID 91862
UniProt ID Q96A59
Protein Families Druggable Genome, Transmembrane
MW 17.7 kDa
Gene Summary As a component of tight junctions, plays a role in paracellular ion conductivity.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' coding region which results in a frameshift compared to variant 1. The resulting protein (isoform 3) is shorter and has a distinct C-terminus compared to isoform 1. There is no support for the protein predicted to be encoded by this variant.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...