FAM113A (PCED1A) (NM_001271168) Human Untagged Clone

CAT#: SC333040

PCED1A (untagged) - Homo sapiens PC-esterase domain containing 1A (PCED1A), transcript variant 2



  "NM_001271168" in other vectors (2)

CNY 3,800.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-FAM113A Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA12M19.1; C20orf81; FAM113A
Vector pCMV6-Entry
Sequence Data
>SC333040 representing NM_001271168.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTCTTCTGTCTGTCGAGCGAGGAGCCGCGCCGCCCGCTGCGAAGCGACATGGTCCACTTCCAGGCC
TCGGAAGTCCAGCAGCTGCTACACAACAAGTTCGTGGTCATCTTGGGGGACTCCATTCAGAGGGCTGTG
TACAAGGACCTGGTGCTCTTGCTCCAGAAAGACTCACTGCTCACAGCTGCCCAGCTGAAAGCCAAGTAC
CTTGAGGATGTTCTGGAAGAGCTGACATATGGACCTGCCCCGGACCTGGTGATCATCAACTCCTGCCTC
TGGGATCTCTCCAGATATGGTCGCTGCTCAATGGAGAGCTACCGGGAGAACCTGGAGCGGGTGTTTGTG
CGCATGGACCAAGTATTGCCAGACTCCTGCCTGCTGGTGTGGAACATGGCGATGCCCCTCGGGGAACGT
ATCACTGGGGGTTTCCTCCTGCCAGAGCTCCAGCCCCTGGCAGGCTCCCTGCGGCGGGATGTGGTTGAA
GGGAACTTCTACAGTGCTACGCTGGCCGGGGACCACTGCTTTGATGTCCTAGACCTCCACTTTCACTTC
CGGCATGCAGTACAGCACCGTCATCGGGATGGTGTCCACTGGGACCAGCATGCACACCGCCACCTCTCA
CACCTGCTTCTGACCCATGTGGCTGACGCCTGGGGCGTGGAGCTGCCCAAGCGTGGCTATCCCCCTGAC
CCGTGGATTGAGGACTGGGCAGAGATGAATCATCCATTCCAGGGAAGCCATAGGCAGACCCCAGACTTC
GGGGAGCACCTGGCCTTGCTCCCACCCCCACCTTCTTCTTTGCCTCCTCCCATGCCTTTTCCCTACCCG
CTTCCTCAGCCCTCGCCACCTCCCCTCTTCCCACCCCTGCCCCAGGATACCCCTTTTTTCCCAGGCCAG
CCCTTCCCACCCCATGAATTCTTCAACTATAATCCAGTGGAGGACTTCTCGATGCCACCCCACTTAGGA
TGTGGCCCTGGAGTGAACTTTGTGCCTGGCCCTCTGCCACCTCCAATCCCTGGCCCTAATCCCCATGGT
CAGCACTGGGGCCCAGTGGTCCACCGGGGGATGCCACGCTATGTTCCTAACAGCCCCTACCATGTGCGG
AGAATGGGGGGGCCCTGCAGGCAGCGGCTCAGACACTCAGAGAGACTGATCCACACATACAAACTGGAC
AGACGGCCTCCTGCCCATTCGGGGACATGGCCTGGGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001271168
Insert Size 1212 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271168.1
RefSeq Size 1774 bp
RefSeq ORF 1212 bp
Locus ID 64773
UniProt ID Q9H1Q7
MW 46 kDa
Gene Summary The protein encoded by this gene is a member of the GDSL/SGNH superfamily. Members of this family are hydrolytic enzymes with esterase and lipase activity and broad substrate specificity. This protein belongs to the Pmr5-Cas1p-esterase subfamily in that it contains the catalytic triad comprised of serine, aspartate and histidine and lacks two conserved regions (glycine after strand S2 and GxND motif). A pseudogene of this gene has been identified on the long arm of chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Sep 2012]
Transcript Variant: This variant (2) differs in the 5' UTR and uses an alternate in-frame splice site in the coding region, compared to variant 1. It encodes isoform 2, which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...