Midkine (MDK) (NM_001270552) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	ARAP; MK; NEGF2
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC332977 representing NM_001270552. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCAGCACCGAGGCTTCCTCCTCCTCACCCTCCTCGCCCTGCTGGCGCTCACCTCCGCGGTCGCCAAA AAGAAAGCCGACTGCAAGTACAAGTTTGAGAACTGGGGTGCGTGTGATGGGGGCACAGGCACCAAAGTC CGCCAAGGCACCCTGAAGAAGGCGCGCTACAATGCTCAGTGCCAGGAGACCATCCGCGTCACCAAGCCC TGCACCCCCAAGACCAAAGCAAAGGCCAAAGCCAAGAAAGGGAAGGGAAAGGACTAG
Restriction Sites	SgfI-MluI
ACCN	NM_001270552
Insert Size	264 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001270552.1
RefSeq Size	730 bp
RefSeq ORF	264 bp
Locus ID	4192
UniProt ID	P21741
Protein Families	Druggable Genome, Secreted Protein, Transmembrane
MW	9.5 kDa
Gene Summary	This gene encodes a member of a small family of secreted growth factors that binds heparin and responds to retinoic acid. The encoded protein promotes cell growth, migration, and angiogenesis, in particular during tumorigenesis. This gene has been targeted as a therapeutic for a variety of different disorders. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (6) differs in the 5' UTR, and lacks an exon in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (b) is shorter than isoform a.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.