p16 ARC (ARPC5) (NM_001270439) Human Untagged Clone
CAT#: SC332932
ARPC5 (untagged) - Homo sapiens actin related protein 2/3 complex, subunit 5, 16kDa (ARPC5), transcript variant 2
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARC16; dJ127C7.3; p16-Arc |
Vector | pCMV6-Entry |
Sequence Data |
>SC332932 representing NM_001270439.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCGAAGAACACAGTGTCGTCGGCCCGCTTCCGGAAGGTGGACGTGGATGAATATGACGAGAACAAG TTCGTGGACGAAGAAGATGGGGGCGACGGCCAGGCCGGGCCCGACGAGGGCGAGGTGGACTCCTGCCTG CGGCATTCCATCACAGGAAACATGACAGCTGCCCTACAGGCAGCTCTGAAGAACCCCCCTATCAACACC AAGAGTCAGGCAGTGAAGGACCGGGCAGGCAGCATTGTCTTGAAGGTGCTCATCTCTTTTAAAGCTAAT GATATAGAAAAGGCAGTTCAATCTCTGGACAAGAATGGTGTGGATCTCCTAATGAAGTATATTTATAAA GGATTTGAGAGCCCGTCTGACAATAGCAGTGCTATGTTACTGCAATGGCATGAAAAGGCACTTGCTGCT GGAGGAGTAGGGTCCATTGTTCGTGTCTTGACTGCAAGAAAAACTGTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270439 |
Insert Size | 465 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001270439.1 |
RefSeq Size | 2094 bp |
RefSeq ORF | 465 bp |
Locus ID | 10092 |
UniProt ID | O15511 |
Protein Pathways | Fc gamma R-mediated phagocytosis, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton |
MW | 16.6 kDa |
Gene Summary | This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells and has been conserved through evolution. The exact role of the protein encoded by this gene, the p16 subunit, has yet to be determined. Alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1. The resulting protein (isoform 2) is longer compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233322 | ARPC5 (Myc-DDK tagged) - Homo sapiens actin related protein 2/3 complex, subunit 5, 16kDa (ARPC5), transcript variant 2 |
CNY 3,990.00 |
|
RG233322 | ARPC5 (tGFP-tagged) - Homo sapiens actin related protein 2/3 complex, subunit 5, 16kDa (ARPC5), transcript variant 2 |
CNY 4,370.00 |
其它p16 ARC产品