APOBEC3B (NM_001270411) Human Untagged Clone

CAT#: SC332926

APOBEC3B (untagged) - Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B), transcript variant 2



  "NM_001270411" in other vectors (2)

CNY 3,420.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-APOBEC3B Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms A3B; APOBEC1L; ARCD3; ARP4; bK150C2.2; DJ742C19.2; PHRBNL
Vector pCMV6-Entry
Sequence Data
>SC332926 representing NM_001270411.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATCCACAGATCAGAAATCCGATGGAGCGGATGTATCGAGACACATTCTACGACAACTTTGAAAAC
GAACCCATCCTCTATGGTCGGAGCTACACTTGGCTGTGCTATGAAGTGAAAATAAAGAGGGGCCGCTCA
AATCTCCTTTGGGACACAGGGGTCTTTCGAGGCCAGGTGTATTTCAAGCCTCAGTACCACGCAGAAATG
TGCTTCCTCTCTTGGTTCTGTGGCAACCAGCTGCCTGCTTACAAGTGTTTCCAGATCACCTGGTTTGTA
TCCTGGACCCCCTGCCCGGACTGTGTGGCGAAGCTGGCCGAATTCCTGTCTGAGCACCCCAATGTCACC
CTGACCATCTCTGCCGCCCGCCTCTACTACTACTGGGAAAGAGATTACCGAAGGGCGCTCTGCAGGCTG
AGTCAGGCAGGAGCCCGCGTGAAGATCATGGACTATGAAGAATTTGCATACTGCTGGGAAAACTTTGTG
TACAATGAAGGTCAGCAATTCATGCCTTGGTACAAATTCGATGAAAATTATGCATTCCTGCACCGCACG
CTAAAGGAGATTCTCAGATACCTGATGGATCCAGACACATTCACTTTCAACTTTAATAATGACCCTTTG
GTCCTTCGACGGCGCCAGACCTACTTGTGCTATGAGGTGGAGCGCCTGGACAATGGCACCTGGGTCCTG
ATGGACCAGCACATGGGCTTTCTATGCAACGAGTTGGACCCGGCCCAGATCTACAGGGTCACTTGGTTC
ATCTCCTGGAGCCCCTGCTTCTCCTGGGGCTGTGCCGGGGAAGTGCGTGCGTTCCTTCAGGAGAACACA
CACGTGAGACTGCGCATCTTCGCTGCCCGCATCTATGATTACGACCCCCTATATAAGGAGGCGCTGCAA
ATGCTGCGGGATGCTGGGGCCCAAGTCTCCATCATGACCTACGATGAGTTTGAGTACTGCTGGGACACC
TTTGTGTACCGCCAGGGATGTCCCTTCCAGCCCTGGGATGGACTAGAGGAGCACAGCCAAGCCCTGAGT
GGGAGGCTGCGGGCCATTCTCCAGAATCAGGGAAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270411
Insert Size 1074 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270411.1
RefSeq Size 1485 bp
RefSeq ORF 1074 bp
Locus ID 9582
UniProt ID Q9UH17
MW 43.1 kDa
Gene Summary This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. A hybrid gene results from the deletion of approximately 29.5 kb of sequence between this gene, APOBEC3B, and the adjacent gene APOBEC3A. The breakpoints of the deletion are within the two genes, so the deletion allele is predicted to have the promoter and coding region of APOBEC3A, but the 3' UTR of APOBEC3B. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) uses an alternate in-frame splice site at the 5' end of a coding exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...