APOBEC3A (NM_001270406) Human Untagged Clone
CAT#: SC332923
APOBEC3A (untagged) - Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A (APOBEC3A), transcript variant 3
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | A3A; ARP3; bK150C2.1; PHRBN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC332923 representing NM_001270406.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAAGCCAGCCCAGCATCCGGGCCCAGGCATAAGACCTACCTGTGCTACGAAGTGGAGCGCCTGGAC AATGGCACCTCGGTCAAGATGGACCAGCACAGGGGCTTTCTACACAACCAGGCTAAGAATCTTCTCTGT GGCTTTTACGGCCGCCATGCGGAGCTGCGCTTCTTGGACCTGGTTCCTTCTTTGCAGTTGGACCCGGCC CAGATCTACAGGGTCACTTGGTTCATCTCCTGGAGCCCCTGCTTCTCCTGGGGCTGTGCCGGGGAAGTG CGTGCGTTCCTTCAGGAGAACACACACGTGAGACTGCGTATCTTCGCTGCCCGCATCTATGATTACGAC CCCCTATATAAGGAGGCACTGCAAATGCTGCGGGATGCTGGGGCCCAAGTCTCCATCATGACCTACGAT GAATTTAAGCACTGCTGGGACACCTTTGTGGACCACCAGGGATGTCCCTTCCAGCCCTGGGATGGACTA GATGAGCACAGCCAAGCCCTGAGTGGGAGGCTGCGGGCCATTCTCCAGAATCAGGGAAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270406 |
Insert Size | 546 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270406.1 |
RefSeq Size | 1390 bp |
RefSeq ORF | 546 bp |
Locus ID | 200315 |
MW | 21 kDa |
Gene Summary | This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. The protein encoded by this gene lacks the zinc binding activity of other family members. The protein plays a role in immunity, by restricting transmission of foreign DNA such as viruses. One mechanism of foreign DNA restriction is deamination of foreign double-stranded DNA cytidines to uridines, which leads to DNA degradation. However, other mechanisms are also thought to be involved, as anti-viral effect is not dependent on deaminase activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (3) uses an alternate in-frame splice site at the 5' end of a coding exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233382 | APOBEC3A (Myc-DDK tagged) - Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A (APOBEC3A), transcript variant 3 |
CNY 3,990.00 |
|
RG233382 | APOBEC3A (tGFP-tagged) - Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A (APOBEC3A), transcript variant 3 |
CNY 5,440.00 |
其它APOBEC3A产品