REG3G (NM_001270040) Human Untagged Clone

CAT#: SC332905

REG3G (untagged) - Homo sapiens regenerating islet-derived 3 gamma (REG3G), transcript variant 3



  "NM_001270040" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-REG3G Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LPPM429; PAP-1B; PAP1B; PAP IB; PAPIB; REG-III; REG III; UNQ429
Vector pCMV6-Entry
Sequence Data
>SC332905 representing NM_001270040.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTGCCTCCCATGGCCCTGCCCAGTGTGTCCTGGATGCTGCTTTCCTGCCTCATTCTCCTGTGTCAG
GTTCAAGGTGAAGAAACCCAGAAGGAACTGCCCTCTCCACGGATCAGCTGTCCCAAAGGCTCCAAGGCC
TATGGCTCCCCCTGCTATGCCTTGTTTTTGTCACCAAAATCCTGGATGGATGCAGATGGCTCTGAGCCT
GATGGAGATGGATGGGAGTGGAGTAGCACTGATGTGATGAATTACTTTGCATGGGAGAAAAATCCCTCC
ACCATCTTAAACCCTGGCCACTGTGGGAGCCTGTCAAGAAGCACAGGATTTCTGAAGTGGAAAGATTAT
AACTGTGATGCAAAGTTACCCTATGTCTGCAAGTTCAAGGACTAG

Restriction Sites SgfI-MluI     
ACCN NM_001270040
Insert Size 390 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270040.1
RefSeq Size 817 bp
RefSeq ORF 390 bp
Locus ID 130120
UniProt ID Q6UW15
Protein Families Secreted Protein
MW 14.4 kDa
Gene Summary This gene encodes a member of the regenerating islet-derived genes (REG)3 protein family. These proteins are secreted, C-type lectins with a carbohydrate recognition domain and N-terminal signal peptide. The protein encoded by this gene is an antimicrobial lectin with activity against Gram-positive bacteria. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...