BORIS (CTCFL) (NM_001269054) Human Untagged Clone

CAT#: SC332904

CTCFL (untagged) - Homo sapiens CCCTC-binding factor (zinc finger protein)-like (CTCFL), transcript variant 15



  "NM_001269054" in other vectors (2)

CNY 3,800.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CTCFL Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BORIS; CT27; CTCF-T; dJ579F20.2; HMGB1L1
Vector pCMV6-Entry
Sequence Data
>SC332904 representing NM_001269054.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTCACCTCTTCTAGAATGTCAAGTTTTAATCGTCATATGAAAACTCACACCAGTGAGAAGCCTCAC
CTGTGTCACCTCTGCCTGAAAACCTTCCGTACGGTCACTCTGCTGCGGAACCATGTTAACACCCACACA
GGAACCAGGCCCTACAAGTGTAACGACTGCAACATGGCATTTGTCACCAGTGGAGAACTCGTCCGACAC
AGGCGCTATAAACATACTCATGAGAAACCCTTTAAATGTTCCATGTGCAAGTATGCCAGTGTGGAGGCA
AGTAAATTGAAGCGCCATGTCCGATCCCACACTGGGGAGCGCCCCTTTCAGTGTTGCCAGTGCAGCTAT
GCCAGCAGAGATACCTACAAGCTGAAACGCCACATGAGAACGCACTCAGGTGAGAAGCCTTACGAATGC
CACATCTGCCACACCCGCTTCACCCAGAGCGGGACCATGAAAATACATATTCTGCAGAAACACGGCGAA
AATGTCCCCAAATACCAGTGTCCCCATTGTGCCACCATCATTGCACGGAAAAGCGACCTACGTGTGCAT
ATGCGCAACTTGCATGCTTACAGCGCTGCAGAGCTGAAATGCCGCTACTGTTCTGCTGTCTTCCATGAA
CGCTATGCCCTCATTCAGCACCAGAAAACTCATAAGAATGAGAAGAGGTTCAAGTGCAAACACTGCAGT
TATGCCTGCAAGCAGGAACGTCATATGACCGCTCACATTCGTACCCACACTGGAGAGAAACCATTCACC
TGCCTTTCTTGCAATAAATGTTTCCGACAGAAGCAACTTCTAAACGCTCACTTCAGGAAATACCACGAT
GCAAATTTCATCCCGACTGTTTACAAATGCTCCAAGTGTGGCAAAGGCTTTTCCCGCTGGATTAACCTG
CACAGACATTCGGAGAAGTGTGGATCAGGGGAAGCAAAGTCGGCTGCTTCAGGAAAGGGAAGAAGAACA
AGAAAGAGGAAGCAGACCATCCTGAAGGAAGCCACAAAGGGTCAGAAGGAAGCTGCGAAGGGATGGAAG
GAAGCCGCGAACGGAGACGGTGTGATCTCAGCTCACCGCAACCTCTGCCTCCTGGGTTCAAGTGATTCT
CATGCCTCAGTCTCCGGAGCTGGGATTACAGATGCCCGCCACCACGCCTGGCTAATTGTTCTATTATTT
TTAGTAGAGATGGGGTTTTACCATGTCTCTCACTCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001269054
Insert Size 1212 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001269054.1
RefSeq Size 2077 bp
RefSeq ORF 1212 bp
Locus ID 140690
UniProt ID Q8NI51
Protein Families Transcription Factors
MW 46.5 kDa
Gene Summary CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (15, also known as B2) differs in the 5' and 3' UTRs and has multiple differences in the coding region, compared to variant 1. The resulting isoform (12) has a shorter N-terminus and a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...