LAT2 (SLC7A8) (NM_001267037) Human Untagged Clone
CAT#: SC332832
SLC7A8 (untagged) - Homo sapiens solute carrier family 7 (amino acid transporter light chain, L system), member 8 (SLC7A8), transcript variant 4
CNY 3,040.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LAT2; LPI-PC1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC332832 representing NM_001267037.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGTCAACTGTTCCAGTGTGCGGTGGGCCACCCGGGTTCAAGACATCTTCACAGCTGGGAAGCTCCT GGCCTTGGCCCTGATTATCATCATGGGGATTGTACAGATATGCAAAGGAACCTTCCCAGAGCCATCTTC ATCTCCATCCCACTGGTCACATTTGTGTATGTCTTTGCCAATGTCGCTTATGTCACTGCAATGTCCCCC CAGGAGCTGCTGGCATCCAACGCCGTCGCTGTGACTTTTGGAGAGAAGCTCCTAGGAGTCATGGCCTGG ATCATGCCCATTTCTGTTGCCCTGTCCACATTTGGAGGAGTTAATGGGTCTCTCTTCACCTCCTCTCGG CTGTTCTTCGCTGGAGCCCGAGAGGGCCACCTTCCCAGTGTGTTGGCCATGATCCACGTGAAGCGCTGC ACCCCAATCCCAGCCCTGCTCTTCACATGCATCTCCACCCTGCTGATGCTGGTCACCAGCGACATGTAC ACACTCATCAACTATGTGGGCTTCATCAACTACCTCTTCTATGGGGTCACGGTTGCTGGACAGATAGTC CTTCGCTGGAAGAAGCCTGATATCCCCCGCCCCATCAAGATCAACCTGCTGTTCCCCATCATCTACTTG CTGTTCTGGGCCTTCCTGCTGGTCTTCAGCCTGTGGTCAGAGCCGGTGGTGTGTGGCATTGGCCTGGCC ATCATGCTGACAGGAGTGCCTGTCTATTTCCTGGGTGTTTACTGGCAACACAAGCCCAAGTGTTTCAGT GACTTCATTGAGCTGCTAACCCTGGTGAGCCAGAAGATGTGTGTGGTCGTGTACCCCGAGGTGGAGCGG GGCTCAGGGACAGAGGAGGCTAATGAGGACATGGAGGAGCAGCAGCAGCCCATGTACCAACCCACTCCC ACGAAGGACAAGGACGTGGCGGGGCAGCCCCAGCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001267037 |
Insert Size | 936 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001267037.1 |
RefSeq Size | 3041 bp |
RefSeq ORF | 936 bp |
Locus ID | 23428 |
UniProt ID | Q9UHI5 |
Protein Families | Druggable Genome, Transmembrane |
MW | 34.6 kDa |
Gene Summary | Sodium-independent, high-affinity transport of small and large neutral amino acids such as alanine, serine, threonine, cysteine, phenylalanine, tyrosine, leucine, arginine and tryptophan, when associated with SLC3A2/4F2hc. Acts as an amino acid exchanger. Has higher affinity for L-phenylalanine than LAT1 but lower affinity for glutamine and serine. L-alanine is transported at physiological concentrations. Plays a role in basolateral (re)absorption of neutral amino acids. Involved in the uptake of methylmercury (MeHg) when administered as the L-cysteine or D,L-homocysteine complexes, and hence plays a role in metal ion homeostasis and toxicity. Involved in the cellular activity of small molecular weight nitrosothiols, via the stereoselective transport of L-nitrosocysteine (L-CNSO) across the transmembrane. Plays an essential role in the reabsorption of neutral amino acids from the epithelial cells to the bloodstream in the kidney.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, initiates translation at an alternate start codon and lacks an exon in the coding region, compared to variant 1. The encoded isoform (d) is shorter and has a distinct N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233718 | SLC7A8 (Myc-DDK tagged) - Homo sapiens solute carrier family 7 (amino acid transporter light chain, L system), member 8 (SLC7A8), transcript variant 4 |
CNY 3,990.00 |
|
RG233718 | SLC7A8 (tGFP-tagged) - Homo sapiens solute carrier family 7 (amino acid transporter light chain, L system), member 8 (SLC7A8), transcript variant 4 |
CNY 4,370.00 |