Myeloid zinc finger 1 (MZF1) (NM_001267033) Human Untagged Clone

CAT#: SC332829

MZF1 (untagged) - Homo sapiens myeloid zinc finger 1 (MZF1), transcript variant 3



  "NM_001267033" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-MZF-1 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MZF-1; MZF1B; ZFP98; ZNF42; ZSCAN6
Vector pCMV6-Entry
Sequence Data
>SC332829 representing NM_001267033.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGGCCTGCGGTGCTGGGCTCCCCAGACCGAGCACCCCCAGAAGATGAGGGGCCTGTCATGGTGAAG
CTAGAGGACTCTGAGGAGGAGGGTGAGGCTGCCTTATGGGACCCAGGCCCTGAAGCTGCACGCCTGCGT
TTCCGGTGCTTCCGCTATGAGGAGGCCACAGGGCCCCAAGAGGCCCTGGCCCAGCTCCGAGAGCTGTGT
CGCCAGTGGCTGCGTCCAGAGGTACGCTCCAAGGAGCAGATGCTGGAGCTGTTGGTGCTGGAGCAGTTC
CTGGGCGCACTGCCCCCTGAGATCCAGGCCCGTGTGCAGGGGCAGCGGCCAGGCAGCCCCGAGGAGGCT
GCTGCCCTAGTAGATGGGCTGCGCCGGGAGCCGGGCGGACCCCGGAGATGGGTCACAGTCCAGGTGCAG
GGCCAGGAGGTCCTATCAGAGAAGATGGAGCCCTCCAGTTTCCAGCCCCTACCTGAAACTGAGCCTCCA
ACTCCAGAGCCTGGGCCCAAGACACCTCCTAGGACTATGCAGGAATCACCACTGGGCCTGCAGGTGAAA
GAGGAGTCAGAGGTTACAGAGGACTCAGATTTCCTGGAGTCTGGGCCTCTAGCTGCCACCCAGGAGTCT
GTACCCACCCTCCTGCCTGAGGAGGCCCAGAGATGTGGGACCGTGCTGGACCAGATCTTTCCCCACAGC
AAGACTGGGCCTGAGGGTCCCTCATGGAGGGAGCACCCCAGGGCCCTGTGGCATGAGGAAGCTGGGGGC
ATCTTCTCCCCAGGGGCCGGAGCCGGGGCCGCCCCAGCACTGGGGGCGGGGTGGTTAGGGGCGGCCGTT
GCGATGTATGTGGCAAGGTGTTCAGCCAACGCAGCAACCTGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001267033
Insert Size 873 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001267033.1
RefSeq Size 2694 bp
RefSeq ORF 873 bp
Locus ID 7593
UniProt ID P28698
Protein Families Transcription Factors
MW 31.5 kDa
Gene Summary Binds to target promoter DNA and functions as transcription regulator. Regulates transcription from the PADI1 and CDH2 promoter. May be one regulator of transcriptional events during hemopoietic development.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...