P2RX4 (NM_001261397) Human Untagged Clone

CAT#: SC332756

P2RX4 (untagged) - Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 4 (P2RX4), transcript variant 5



  "NM_001261397" in other vectors (2)

CNY 3,520.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
P2RX4 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms P2X4; P2X4R
Vector pCMV6-Entry
Sequence Data
>SC332756 representing NM_001261397.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGGCTGCTGCGCCGCGCTGGCGGCCTTCCTGTTCGAGTACGACACGCCGCGCATCGTGCTCATC
CGCAGCCGCAAAGTGGGGCTCATGAACCGCGCCGTGCAACTGCTCATCCTGGCCTACGTCATCGGGTGG
GTGTTTGTGTGGGAAAAGGGCTACCAGGAAACTGACTCCGTGGTCAGCTCCGTTACGACCAAGGTCAAG
GGCGTGGCTGTGACCAACACTTCTAAACTTGGATTCCGGATCTGGGATGTGGCGGATTATGTGATACCA
GCTCAGGAGGAAAACTCCCTCTTCGTCATGACCAACGTGATCCTCACCATGAACCAGACACAGGGCCTG
TGCCCCGAGATTCCAGATGCGACCACTGTGTGTAAATCAGATGCCAGCTGTACTGCCGGCTCTGCCGGC
ACCCACAGCAACGGAGTCTCAACAGGCAGACCTGCTTTTTTAAAGGCTGCAGAAAACTTCACTCTTTTG
GTTAAGAACAACATCTGGTATCCCAAATTTAATTTCAGCAAGAGGAATATCCTTCCCAACATCACCACT
ACTTACCTCAAGTCGTGCATTTATGATGCTAAAACAGATCCCTTCTGCCCCATATTCCGTCTTGGCAAA
ATAGTGGAGAACGCAGGACACAGTTTCCAGGACATGGCCGTGGAGGGAGGCATCATGGGCATCCAGGTC
AACTGGGACTGCAACCTGGACAGAGCCGCCTCCCTCTGCTTGCCCAGGTACTCCTTCCGCCGCCTCGAT
ACACGGGACGTTGAGCACAACGTATCTCCTGGCTACAATTTCAGGTTTGCCAAGTACTACAGAGACCTG
GCTGGCAACGAGCAGCGCACGCTCATCAAGGCCTATGGCATCCGCTTCGACATCATTGTGTTTGGGAAG
GCAGGGAAATTTGACATCATCCCCACTATGATCAACATCGGCTCTGGCCTGGCACTGCTAGGCATGGCG
ACCGTGCTGTGTGACATCATAGTCCTCTACTGCATGAAGAAAAGACTCTACTATCGGGAGAAGAAATAT
AAATATGTGGAAGATTACGAGCAGGGTCTTGCTAGTGAGCTGGACCAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001261397
Insert Size 1086 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001261397.1
RefSeq Size 2023 bp
RefSeq ORF 1086 bp
Locus ID 5025
UniProt ID Q99571
Protein Families Druggable Genome, Ion Channels: ATP Receptors, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
MW 40.5 kDa
Gene Summary The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (5) lacks an in-frame exon in the 5' coding region and an in-frame segment in the central coding region, compared to variant 1. The resulting isoform (3) lacks two internal segments, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...