Radixin (RDX) (NM_001260495) Human Untagged Clone

CAT#: SC332740

RDX (untagged) - Homo sapiens radixin (RDX), transcript variant 5



  "NM_001260495" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RDX Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DFNB24
Vector pCMV6-Entry
Sequence Data
>SC332740 representing NM_001260495.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAACGTCTAAAACAAATTGAAGAGCAGACAATTAAAGCTCAGAAAGAACTAGAAGAACAGACTCGA
AAAGCTCTAGAACTGGATCAAGAACGAAAACGAGCAAAAGAAGAAGCAGAACGACTTGAAAAGGAGCGT
CGAGCTGCTGAAGAGGCAAAGTCTGCCATAGCAAAACAAGCTGCCGACCAGATGAAGAATCAGGAGCAG
CTAGCAGCAGAACTTGCTGAATTCACTGCCAAGATTGCACTTCTAGAGGAAGCCAAGAAGAAAAAGGAA
GAGGAAGCTACTGAGTGGCAACACAAAGCTTTTGCAGCCCAGGAAGACTTGGAAAAGACCAAAGAAGAG
TTAAAAACTGTGATGTCTGCCCCCCCTCCACCTCCACCACCACCAGTCATTCCTCCAACAGAAAACGAA
CATGATGAACACGATGAGAATAATGCTGAAGCTAGTGCTGAATTATCAAATGAAGGGGTAATGAACCAT
AGAAGCGAGGAAGAACGTGTAACCGAAACACAGAAAAATGAGCGTGTTAAGAAGCAACTTCAGGCATTA
AGTTCAGAATTAGCCCAAGCCAGAGATGAAACCAAGAAAACACAAAATGATGTTCTTCATGCTGAGAAT
GTTAAAGCAGGCCGTGATAAGTACAAGACTCTGCGACAGATTCGACAAGGCAATACAAAGCAGCGTATC
GATGAGTTTGAAGCAATGTGGGGACCCAAACTGTATGCATTGTTCCAGATGCGCTCTTGCCAAAGCAGC
ATAAAGCAAATGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001260495
Insert Size 774 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001260495.1
RefSeq Size 1814 bp
RefSeq ORF 774 bp
Locus ID 5962
UniProt ID P35241
Protein Families Druggable Genome
Protein Pathways Regulation of actin cytoskeleton
MW 29.7 kDa
Gene Summary Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (5) lacks multiple exons in the coding region, compared to variant 1. The resulting isoform (4) lacks two internal segments, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...