TMEM218 (NM_001258246) Human Untagged Clone

CAT#: SC332604

TMEM218 (untagged) - Homo sapiens transmembrane protein 218 (TMEM218), transcript variant 4



  "NM_001258246" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC332604 representing NM_001258246.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCCTGGTGTCTTCTACCAGTTCTTAGTGTGTTGCACTGGAGCACAGAGGACACTCGATCGTGCGGC
GCGCAGGGCGGGGGGCCGCCGCTGCCTCCCCGCGGGATGGCTGGCACTGTGCTCGGAGTCGGTGCGGGC
GTGTTCATCTTAGCCCTGCTCTGGGTGGCAGTGCTGCTGCTGTGTGTGCTGCTGTCCAGAGCCTCCGGG
GCGGCGAGGTTCTCTGTCATTTTTTTATTCTTCGGTGCTGTGATCATCACATCAGTTCTGTTGCTTTTC
CCGCGAGCTGGTGAATTCCCAGCCCCAGAAGTGGAAGTTAAGATTGTGGATGACTTTTTCATTGGCCGC
TATGTCCTGCTGGCTTTCCTTAGTGCCATCTTCCTTGGAGGCCTCTTCTTGGTTTTAATCCATTATGTT
CTGGAGCCGATCTATGCCAAACCACTGCACTCCTACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001258246
Insert Size 453 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001258246.1
RefSeq Size 3988 bp
RefSeq ORF 453 bp
Locus ID 219854
UniProt ID A2RU14
Protein Families Transmembrane
MW 16.2 kDa
Gene Summary May be involved in ciliary biogenesis or function.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3, and 4 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...