AMCase (CHIA) (NM_001258005) Human Untagged Clone

CAT#: SC332565

CHIA (untagged) - Homo sapiens chitinase, acidic (CHIA), transcript variant 9



  "NM_001258005" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
CHIA mouse monoclonal antibody,clone OTI3H4
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AMCASE; CHIT2; TSA1902
Vector pCMV6-Entry
Sequence Data
>SC332565 representing NM_001258005.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGTGAAGCTTTTGAGCAGGAGGCCAAGCAGATCAACAAGCCCAGGCTGATGGTCACTGCTGCAGTA
GCTGCTGGCATCTCCAATATCCAGTCTGGCTATGAGATCCCCCAACTGTCACAGTACCTGGACTACATC
CATGTCATGACCTACGACCTCCATGGCTCCTGGGAGGGCTACACTGGAGAGAACAGCCCCCTCTACAAA
TACCCGACTGACACCGGCAGCAACGCCTACCTCAATGTGGATTATGTCATGAACTACTGGAAGGACAAT
GGAGCACCAGCTGAGAAGCTCATCGTTGGATTCCCTACCTATGGACACAACTTCATCCTGAGCAACCCC
TCCAACACTGGAATTGGTGCCCCCACCTCTGGTGCTGGTCCTGCTGGGCCCTATGCCAAGGAGTCTGGG
ATCTGGGCTTACTACGAGATCTGTACCTTCCTGAAAAATGGAGCCACTCAGGGATGGGATGCCCCTCAG
GAAGTGCCTTATGCCTATCAGGGCAATGTGTGGGTTGGCTATGACAACATCAAGAGCTTCGATATTAAG
GCTCAATGGCTTAAGCACAACAAATTTGGAGGCGCCATGGTCTGGGCCATTGATCTGGATGACTTCACT
GGCACTTTCTGCAACCAGGGCAAGTTTCCCCTAATCTCCACCCTGAAGAAGGCCCTCGGCCTGCAGAGT
GCAAGTTGCACGGCTCCAGCTCAGCCCATTGAGCCAATAACTGCTGCTCCCAGTGGCAGCGGGAACGGG
AGCGGGAGTAGCAGCTCTGGAGGCAGCTCGGGAGGCAGTGGATTCTGTGCTGTCAGAGCCAACGGCCTC
TACCCCGTGGCAAATAACAGAAATGCCTTCTGGCACTGCGTGAATGGAGTCACGTACCAGCAGAACTGC
CAGGCCGGGCTTGTCTTCGACACCAGCTGTGATTGCTGCAACTGGGCATAA

Restriction Sites SgfI-MluI     
ACCN NM_001258005
Insert Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001258005.1
RefSeq Size 1510 bp
RefSeq ORF 948 bp
Locus ID 27159
UniProt ID Q9BZP6
Protein Families Secreted Protein
Protein Pathways Amino sugar and nucleotide sugar metabolism
MW 33.9 kDa
Gene Summary The protein encoded by this gene degrades chitin, which is found in the cell wall of most fungi as well as in arthropods and some nematodes. The encoded protein can also stimulate interleukin 13 expression, and variations in this gene can lead to asthma susceptibility. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (9) lacks exons and contains another exon in the 5' coding region, initiating translation at a downstream AUG compared to variant 4. The encoded isoform (b, also known as TSA1902-S) has a shorter N-terminus and lacks a signal peptide compared to isoform c. Variants 3, 6, 8, and 9 all encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...