Beta Arrestin 2 (ARRB2) (NM_001257329) Human Untagged Clone

CAT#: SC332526

ARRB2 (untagged) - Homo sapiens arrestin, beta 2 (ARRB2), transcript variant 4



  "NM_001257329" in other vectors (2)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
ARRB2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARB2; ARR2; BARR2
Vector pCMV6-Entry
Sequence Data
>SC332526 representing NM_001257329.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACCGTGTACTTG
GGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGATGGCGTGGTGCTTGTGGACCCT
GACTACCTGAAGGACCGCAAAGTGTTTGTGACCCTCACCTGCGCCTTCCGCTATGGCCGTGAAGACCTG
GATGTGCTGGGCTTGTCCTTCCGCAAAGACCTGTTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCC
AACCCACCCCGGCCCCCCACCCGCCTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCC
TTCTTCTTCACCATACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGA
AAGGCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGCCACAAA
AGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCCGGCCCCCAGCCTTCA
GCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCACCTCGAGGCTTCCCTGGACAAGGAG
CTGTACTACCATGGGGAGCCCCTCAATGTAAATGTCCACGTCACCAACAACTCCACCAAGACCGTCAAG
AAGATCAAAGTCTCTGTGAGACAGTACGCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCT
GTGGCTCAACTCGAACAAGATGACCAGCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTGGT
GTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAGCTGCCTTTTGT
TCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAGTCAGCCGCTCCGGAGACAGA
TGTCCCTGTGGACACCAACCTCATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001257329
Insert Size 993 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257329.1
RefSeq Size 1805 bp
RefSeq ORF 993 bp
Locus ID 409
UniProt ID P32121
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway, Endocytosis, MAPK signaling pathway, Olfactory transduction
MW 36.6 kDa
Gene Summary Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (4) uses an alternate in-frame splice junction at the 3' end of an exon and uses an alternate splice junction at the 3' end of another exon, that causes a frameshift. The resulting isoform (4) lacks an alternate internal segment and has a shorter and distinct C-terminus compared to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...