DDX19B (NM_001257173) Human Untagged Clone

CAT#: SC332513

DDX19B (untagged) - Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B (DDX19B), transcript variant 5



  "NM_001257173" in other vectors (2)

CNY 3,520.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-DDX19B Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DBP5; DDX19; RNAh
Vector pCMV6-Entry
Sequence Data
>SC332513 representing NM_001257173.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGTTTCAATCGTCCATCCAAGATACAAGAGAACGCATTGCCACTGATGCTTGCTGAGCCCCCACAG
AACTTAATTGCCCAATCTCAGTCTGGTACTGGTAAAACAGCTGCCTTCGTGCTGGCCATGCTTAGCCAA
GTAGAACCTGCAAACAAATACCCCCAGTGTCTATGTCTCTCCCCAACGTATGAGCTCGCCCTCCAAACA
GGAAAAGTGATTGAACAAATGGGCAAATTTTACCCTGAACTGAAGCTAGCTTATGCTGTTCGAGGCAAT
AAATTGGAAAGAGGCCAGAAGATCAGTGAGCAGATTGTCATTGGCACCCCTGGGACTGTGCTGGACTGG
TGCTCCAAGCTCAAGTTCATTGATCCCAAGAAAATCAAGGTGTTTGTTCTGGATGAGGCTGATGTCATG
ATAGCCACTCAGGGCCACCAAGATCAGAGCATCCGCATCCAGAGGATGCTGCCCAGGAACTGCCAGATG
CTGCTTTTCTCCGCCACCTTTGAAGACTCTGTGTGGAAGTTTGCCCAGAAAGTGGTCCCAGACCCAAAC
GTTATCAAACTGAAGCGTGAGGAAGAGACCCTGGACACCATCAAGCAGTACTATGTCCTGTGCAGCAGC
AGAGACGAGAAGTTCCAGGCCTTGTGTAACCTCTACGGGGCCATCACCATTGCTCAAGCCATGATCTTC
TGCCATACTCGCAAAACAGCTAGTTGGCTGGCAGCAGAGCTCTCAAAAGAAGGCCACCAGGTGGCTCTG
CTGAGTGGGGAGATGATGGTGGAACAGAGGGCTGCAGTGATTGAGCGCTTCCGAGAGGGCAAAGAGAAG
GTTTTGGTGACCACCAACGTGTGTGCCCGCGGCATTGATGTTGAACAAGTGTCTGTCGTCATCAACTTT
GATCTTCCCGTGGACAAGGACGGGAATCCTGACAATGAGACCTACCTGCACCGGATCGGGCGCACGGGC
CGCTTTGGCAAGAGGGGCCTGGCAGTGAACATGGTGGACAGCAAGCACAGCATGAACATCCTGAACAGA
ATCCAGGAGCATTTTAATAAGAAGATAGAAAGATTGGACACAGATGATTTGGACGAGATTGAGAAAATA
GCCAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001257173
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001257173.1
RefSeq Size 1818 bp
RefSeq ORF 1113 bp
Locus ID 11269
UniProt ID Q9UMR2
MW 41.8 kDa
Gene Summary DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which exhibits RNA-dependent ATPase and ATP-dependent RNA-unwinding activities. This protein is recruited to the cytoplasmic fibrils of the nuclear pore complex, where it participates in the export of mRNA from the nucleus. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an downstream start codon, compared to variant 1. Variants 3, 5 and 6 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...