NDUFB3 (NM_001257102) Human Untagged Clone

CAT#: SC332503

NDUFB3 (untagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa (NDUFB3), transcript variant 2



  "NM_001257102" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NDUFB3 mouse monoclonal antibody,clone OTI4B2
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B12; CI-B12; MC1DN25
Vector pCMV6-Entry
Sequence Data
>SC332503 representing NM_001257102.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCCATGAACATGGACATGAGCATGGACATCATAAAATGGAACTTCCAGATTATAGACAATGGAAG
ATAGAAGGGACACCATTAGAAACTATCCAGAAGAAGCTGGCTGCAAAAGGGCTAAGGGATCCATGGGGC
CGCAATGAAGCTTGGAGATACATGGGTGGCTTTGCAAAGAGTGTTTCCTTTTCTGATGTATTCTTTAAA
GGATTCAAATGGGGATTTGCTGCATTTGTGGTAGCTGTAGGAGCTGAATATTACCTGGAGTCCCTGAAT
AAAGATAAGAAGCATCACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001257102
Insert Size 297 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001257102.1
RefSeq Size 793 bp
RefSeq ORF 297 bp
Locus ID 4709
UniProt ID O43676
Protein Families Transmembrane
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
MW 11.4 kDa
Gene Summary This gene encodes an accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which is the first enzyme in the electron transport chain of mitochondria. This protein localizes to the inner membrane of the mitochondrion as a single-pass membrane protein. Mutations in this gene contribute to mitochondrial complex 1 deficiency. Alternative splicing results in multiple transcript variants encoding the same protein. Humans have multiple pseudogenes of this gene. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (2) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...