NDUFB3 (NM_001257102) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	B12; CI-B12; MC1DN25
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC332503 representing NM_001257102. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCCATGAACATGGACATGAGCATGGACATCATAAAATGGAACTTCCAGATTATAGACAATGGAAG ATAGAAGGGACACCATTAGAAACTATCCAGAAGAAGCTGGCTGCAAAAGGGCTAAGGGATCCATGGGGC CGCAATGAAGCTTGGAGATACATGGGTGGCTTTGCAAAGAGTGTTTCCTTTTCTGATGTATTCTTTAAA GGATTCAAATGGGGATTTGCTGCATTTGTGGTAGCTGTAGGAGCTGAATATTACCTGGAGTCCCTGAAT AAAGATAAGAAGCATCACTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001257102
Insert Size	297 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001257102.1
RefSeq Size	793 bp
RefSeq ORF	297 bp
Locus ID	4709
UniProt ID	O43676
Protein Families	Transmembrane
Protein Pathways	Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
MW	11.4 kDa
Gene Summary	This gene encodes an accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which is the first enzyme in the electron transport chain of mitochondria. This protein localizes to the inner membrane of the mitochondrion as a single-pass membrane protein. Mutations in this gene contribute to mitochondrial complex 1 deficiency. Alternative splicing results in multiple transcript variants encoding the same protein. Humans have multiple pseudogenes of this gene. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (2) represents the longer transcript. Variants 1 and 2 encode the same protein.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.