carabin (TBC1D10C) (NM_001256508) Human Untagged Clone

CAT#: SC332406

TBC1D10C (untagged) - Homo sapiens TBC1 domain family, member 10C (TBC1D10C), transcript variant 2



  "NM_001256508" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Carabin Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CARABIN; EPI64C
Vector pCMV6-Entry
Sequence Data
>SC332406 representing NM_001256508.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCCAGGCCCTGGGGGAGGACCTGGTGCAGCCTCCCGAGCTGCAGGATGACTCCAGCTCCTTGGGG
TCCGACTCAGAGCTCAGCGGGCCTGGCCCATATCGCCAGGCCGACCGCTATGGATTCATTGGGGGCAGC
TCAGCAGAGCCAGGGCCGGGCCACCCACCTGCAGACCTCATCCGCCAACGGGAGATGAAGTGGGTGGAG
ATGACCTCGCACTGGGAGAAAACCATGTCCCGGCGGTACAAGAAGGTAAAGATGCAGTGCCGGAAAGGC
ATCCCGTCTGCCCTGCGCGCCCGATGCTGGCCCCTGTTGTGTGGGGCCCATGTGTGCCAGAAGAACAGC
CCTGGCACCTATCAGGAGCTGGCAGAGGCCCCTGGAGACCCACAGTGGATGGAGACCATTGGCAGGGAC
CTGCACCGTCAATTCCCTCTGCACGAGATGTTTGTGTCGCCTCAGGGCCACGGCAGGGGCTCCTGCAGG
TGCTCAAGGCCTACACCCTGTATCGACCGGAGCAGGGCTACTGCCAGGCCCAGGGGCCCGTGGCTGCTG
TGCTGCTCATGCACCTGCCCCCAGAGGAGGCCTTCTGGTGCCTGGTGCAGATCTGTGAGGTCTACCTCC
CTGGGTACTACGGGCCCCACATGGTGCCAGAGTACTGTTCCGTGTGGGGCTGACACTGGTGCGCCTGGC
GCTGGGCACTGCAGAGCAGCGAGGGGCCTGCCCTGGCCTCCTGGAGACACTGGGAGCCCTTCGAGCCAT
CCCCCCCGCGCAGCTGCAGGAGGAGGCCTTCATGTCACAGGTGCACAGCGTGGTGCTGTCAGAGCGGGA
CCTGCAGCGGGAGATCAAGGCCCAGCTGGCCCAGCTGCCCGATTCCGCGCCGGGACCCCCGCCCCGGCC
ACAGGTCCGCCTCGCCGGGGCCCAAGCCATCTTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256508
Insert Size 933 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256508.1
RefSeq Size 1541 bp
RefSeq ORF 933 bp
Locus ID 374403
UniProt ID Q8IV04
MW 32.9 kDa
Gene Summary The protein encoded by this gene has an N-terminal Rab-GTPase domain and a binding site at the C-terminus for calcineurin, and is an inhibitor of both the Ras signaling pathway and calcineurin, a phosphatase regulated by calcium and calmodulin. Genes encoding similar proteins are located on chromosomes 16 and 22. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) uses two alternate splice sites and lacks an exon in the 3' coding region which results in a frameshift compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...