CHST9 (NM_001256316) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	GALNAC4ST-2; GalNAc4ST2
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC332346 representing NM_001256316. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCAGCCATCTGAAATGGTCATGAACCCCAAACAAGTCTTCCTCTCTGTGCTGATATTTGGAGTAGCT GGGCTACTCCTCTTCATGTATTTGCAAGTCTGGATTGAAGAACAACATACAGGGAGAGTGGAGAAGAGA AGAGAACAAAAAGTAACTTCAGGATGGGGACCAGTGAAGTACTTGCGGCCTGTACCCAGAATCAAACCC CAAGTTTCACATGCCTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001256316
Insert Size	225 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001256316.1
RefSeq Size	2242 bp
RefSeq ORF	225 bp
Locus ID	83539
UniProt ID	Q7L1S5
Protein Families	Transmembrane
MW	8.6 kDa
Gene Summary	The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of non-reducing N-acetylgalactosamine (GalNAc) residues in both N-glycans and O-glycans. Sulfate groups on carbohydrates confer highly specific functions to glycoproteins, glycolipids, and proteoglycans, and are critical for cell-cell interaction, signal transduction, and embryonic development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (3) lacks an alternate exon that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (2) has a distinct and significantly shorter C-terminus, compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.