CHST9 (NM_001256316) Human Untagged Clone
CAT#: SC332346
CHST9 (untagged) - Homo sapiens carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 (CHST9), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GALNAC4ST-2; GalNAc4ST2 |
Vector | pCMV6-Entry |
Sequence Data |
>SC332346 representing NM_001256316.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCAGCCATCTGAAATGGTCATGAACCCCAAACAAGTCTTCCTCTCTGTGCTGATATTTGGAGTAGCT GGGCTACTCCTCTTCATGTATTTGCAAGTCTGGATTGAAGAACAACATACAGGGAGAGTGGAGAAGAGA AGAGAACAAAAAGTAACTTCAGGATGGGGACCAGTGAAGTACTTGCGGCCTGTACCCAGAATCAAACCC CAAGTTTCACATGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256316 |
Insert Size | 225 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001256316.1 |
RefSeq Size | 2242 bp |
RefSeq ORF | 225 bp |
Locus ID | 83539 |
UniProt ID | Q7L1S5 |
Protein Families | Transmembrane |
MW | 8.6 kDa |
Gene Summary | The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of non-reducing N-acetylgalactosamine (GalNAc) residues in both N-glycans and O-glycans. Sulfate groups on carbohydrates confer highly specific functions to glycoproteins, glycolipids, and proteoglycans, and are critical for cell-cell interaction, signal transduction, and embryonic development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (3) lacks an alternate exon that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (2) has a distinct and significantly shorter C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233236 | CHST9 (Myc-DDK tagged) - Homo sapiens carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 (CHST9), transcript variant 3 |
CNY 3,990.00 |
|
RG233236 | CHST9 (tGFP-tagged) - Homo sapiens carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 (CHST9), transcript variant 3 |
CNY 4,370.00 |