RND3 (NM_001254738) Human Untagged Clone

CAT#: SC332265

RND3 (untagged) - Homo sapiens Rho family GTPase 3 (RND3), transcript variant 1



  "NM_001254738" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RND3 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARHE; memB; Rho8; RhoE
Vector pCMV6-Entry
Sequence Data
>SC332265 representing NM_001254738.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGGAGAGAAGAGCCAGCCAGAAATTATCCAGCAAATCTATCATGGATCCTAATCAGAACGTGAAA
TGCAAGATAGTTGTGGTGGGAGACAGTCAGTGTGGAAAAACTGCGCTGCTCCATGTCTTCGCCAAGGAC
TGCTTCCCCGAGAATTACGTTCCTACAGTGTTTGAGAATTACACGGCCAGTTTTGAAATCGACACACAA
AGAATAGAGTTGAGCCTGTGGGACACTTCGGGTTCTCCTTACTATGACAATGTCCGCCCCCTCTCTTAC
CCTGATTCGGATGCTGTGCTGATTTGCTTTGACATCAGTAGACCAGAGACCCTGGACAGTGTCCTCAAA
AAGTGGAAAGGTGAAATCCAGGAATTTTGTCCAAATACCAAAATGCTCTTGGTCGGCTGCAAGTCTGAT
CTGCGGACAGATGTTAGTACATTAGTAGAGCTCTCCAATCACAGGCAGACGCCAGTGTCCTATGACCAG
GGGGCAAATATGGCCAAACAGATTGGAGCAGCTACTTATATCGAATGCTCAGCTTTACAGTCGGAAAAT
AGCGTCAGAGACATTTTTCACGTTGCCACCTTGGCATGTGTAAATAAGACAAATAAAAACGTTAAGCGG
AACAAATCACAGAGAGCCACAAAGCGGATTTCACACATGCCTAGCAGACCAGAACTCTCGGCAGTTGCT
ACGGACTTACGAAAGGACAAAGCGAAGAGCTGCACTGTGATGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001254738
Insert Size 735 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001254738.1
RefSeq Size 2807 bp
RefSeq ORF 735 bp
Locus ID 390
UniProt ID P61587
MW 27.4 kDa
Gene Summary This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...