UXS 1 (UXS1) (NM_001253875) Human Untagged Clone

CAT#: SC332247

UXS1 (untagged) - Homo sapiens UDP-glucuronate decarboxylase 1 (UXS1), transcript variant 1



  "NM_001253875" in other vectors (2)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


UXS1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SDR6E1; UGD
Vector pCMV6-Entry
Sequence Data
>SC332247 representing NM_001253875.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGAGCAAGGCGCTGCTGCGCCTCGTGTCTGCCGTCAACCGCAGGAGGATGAAGCTGCTGCTGGGC
ATCGCCTTGCTGGCCTACGTCGCCTCTGTTTGGGGCAACTTCGTTAATATGAGCTTTCTACTCAACAGG
TCTATCCAGGAAAATGGTGAACTAAAAATTGAAAGCAAGATTGAAGAGATGGTTGAACCACTAAGAGAG
AAAATCAGAGATTTAGAAAAAAGCTTTACCCAGAAATACCCACCAGTAAAGTTTTTATCAGAAAAGGAT
CGGAAAAGAATTTTGATAACAGGAGGCGCAGGGTTCGTGGGCTCCCATCTAACTGACAAACTCATGATG
GACGGCCACGAGGTGACCGTGGTGGACAATTTCTTCACGGGCAGGAAGAGAAACGTGGAGCACTGGATC
GGACATGAGAACTTCGAGTTGATTAACCACGACGTGGTGGAGCCCCTCTACATCGAGGTTGACCAGATA
TACCATCTGGCATCTCCAGCCTCCCCTCCAAACTACATGTATAATCCTATCAAGACATTAAAGACCAAT
ACGATTGGGACATTAAACATGTTGGGGCTGGCAAAACGAGTCGGTGCCCGTCTGCTCCTGGCCTCCACA
TCGGAGGTGTATGGAGATCCTGAAGTCCACCCTCAAAGTGAGGATTACTGGGGCCACGTGAATCCAATA
GGACCTCGGGCCTGCTACGATGAAGGCAAACGTGTTGCAGAGACCATGTGCTATGCCTACATGAAGCAG
GAAGGCGTGGAAGTGCGAGTGGCCAGAATCTTCAACACCTTTGGGCCACGCATGCACATGAACGATGGG
CGAGTAGTCAGCAACTTCATCCTGCAGGCGCTCCAGGGGGAGCCACTCACGGTATACGGATCCGGGTCT
CAGACAAGGGCGTTCCAGTACGTCAGCGATCTAGTGAATGGCCTCGTGGCTCTCATGAACAGCAACGTC
AGCAGCCCGGTCAACCTGGGGAACCCAGAAGAACACACAATCCTAGAATTTGCTCAGTTAATTAAAAAC
CTTGTTGGTAGCGGAAGTGAAATTCAGTTTCTCTCCGAAGCCCAGGATGACCCACAGAAAAGAAAACCA
GACATCAAAAAAGCAAAGCTGATGCTGGGGTGGGAGCCCGTGGTCCCGCTGGAGGAAGGTTTAAACAAA
GCAATTCACTACTTCCGTAAAGAACTCGAGTACCAGGCAAATAATCAGTACATCCCCAAACCAAAGCCT
GCCAGAATAAAGAAAGGACGGACTCGCCACAGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001253875
Insert Size 1278 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001253875.1
RefSeq Size 2117 bp
RefSeq ORF 1278 bp
Locus ID 80146
UniProt ID Q8NBZ7
Protein Families Transmembrane
Protein Pathways Amino sugar and nucleotide sugar metabolism, Metabolic pathways, Starch and sucrose metabolism
MW 48.2 kDa
Gene Summary This gene encodes an enzyme found in the perinuclear Golgi which catalyzes the synthesis of UDP-xylose used in glycosaminoglycan (GAG) synthesis on proteoglycans. The GAG chains are covalently attached to proteoglycans which participate in signaling pathways during development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (1) encodes the longest protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...