GPR172A (SLC52A2) (NM_001253816) Human Untagged Clone

CAT#: SC332235

SLC52A2 (untagged) - Homo sapiens solute carrier family 52 (riboflavin transporter), member 2 (SLC52A2), transcript variant 3



  "NM_001253816" in other vectors (2)

CNY 4,280.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-G protein-coupled receptor 172A (SLC52A2/PEVR1) antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BVVLS2; D15Ertd747e; GPCR41; GPR172A; hRFT3; PAR1; RFT3; RFVT2
Vector pCMV6-Entry
Sequence Data
>SC332235 representing NM_001253816.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGCACCCACGCCCGCCCGTCCGGTGCTGACCCACCTGCTGGTGGCTCTCTTCGGCATGGGCTCC
TGGGCTGCGGTCAATGGGATCTGGGTGGAGCTACCTGTGGTGGTCAAAGAGCTTCCAGAGGGTTGGAGC
CTCCCCTCTTACGTCTCTGTGCTTGTGGCTCTGGGGAACCTGGGTCTGCTGGTGGTGACCCTCTGGAGG
AGGCTGGCCCCAGGAAAGGACGAGCAGGTCCCCATCCGGGTGGTGCAGGTGCTGGGCATGGTGGGCACA
GCCCTGCTGGCCTCTCTGTGGCACCATGTGGCCCCAGTGGCAGGACAGTTGCATTCTGTGGCCTTCTTA
GCACTGGCCTTTGTGCTGGCACTGGCATGCTGTGCCTCGAATGTCACTTTCCTGCCCTTCTTGAGCCAC
CTGCCACCTCGCTTCTTACGGTCATTCTTCCTGGGTCAAGGCCTGAGTGCCCTGCTGCCCTGCGTGCTG
GCCCTAGTGCAGGGTGTGGGCCGCCTCGAGTGCCCGCCAGCCCCCATCAACGGCACCCCTGGCCCCCCG
CTCGACTTCCTTGAGCGTTTTCCCGCCAGCACCTTCTTCTGGGCACTGACTGCCCTTCTGGTCGCTTCA
GCTGCTGCCTTCCAGGGTCTTCTGCTGCTGTTGCCGCCACCACCATCTGTACCCACAGGGGAGTTAGGA
TCAGGCCTCCAGGTGGGAGCCCCAGGAGCAGAGGAAGAGGTGGAAGAGTCCTCACCACTGCAAGAGCCA
CCAAGCCAGGCAGCAGGCACCACCCCTGGTCCAGACCCTAAGGCCTATCAGCTTCTATCAGCCCGCAGT
GCCTGCCTGCTGGGCCTGTTGGCCGCCACCAACGCGCTGACCAATGGCGTGCTGCCTGCCGTGCAGAGC
TTTTCCTGCTTACCCTACGGGCGTCTGGCCTACCACCTGGCTGTGGTGCTGGGCAGTGCTGCCAATCCC
CTGGCCTGCTTCCTGGCCATGGGTGTGCTGTGCAGGTCCTTGGCAGGGCTGGGCGGCCTCTCTCTGCTG
GGCGTGTTCTGTGGGGGCTACCTGATGGCGCTGGCAGTCCTGAGCCCCTGCCCGCCCCTGGTGGGCACC
TCGGCGGGGGTGGTCCTCGTGGTGCTGTCGTGGGTGCTGTGTCTTGGCGTGTTCTCCTACGTGAAGGTG
GCAGCCAGCTCCCTGCTGCATGGCGGGGGCCGGCCGGCATTGCTGGCAGCCGGCGTGGCCATCCAGGTG
GGCTCTCTGCTCGGCGCTGTTGCTATGTTCCCCCCGACCAGCATCTATCACGTGTTCCACAGCAGAAAG
GACTGTGCAGACCCCTGTGACTCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001253816
Insert Size 1338 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001253816.1
RefSeq Size 1786 bp
RefSeq ORF 1338 bp
Locus ID 79581
UniProt ID Q9HAB3
Protein Families Druggable Genome, GPCR, Transmembrane
MW 45.8 kDa
Gene Summary This gene encodes a membrane protein which belongs to the riboflavin transporter family. In humans, riboflavin must be obtained by intestinal absorption because it cannot be synthesized by the body. The water-soluble vitamin riboflavin is processed to the coenzymes flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) which then act as intermediaries in many cellular metabolic reactions. Paralogous members of the riboflavin transporter gene family are located on chromosomes 17 and 20. Unlike other members of this family, this gene has higher expression in brain tissue than small intestine. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. Mutations in this gene have been associated with Brown-Vialetto-Van Laere syndrome 2 - an autosomal recessive progressive neurologic disorder characterized by deafness, bulbar dysfunction, and axial and limb hypotonia. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 5, 6 and 7 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...