CREB3L2 (NM_001253775) Human Untagged Clone

CAT#: SC332224

CREB3L2 (untagged) - Homo sapiens cAMP responsive element binding protein 3-like 2 (CREB3L2), transcript variant 2



  "NM_001253775" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CREB3L2 Antibody
    • 100 ug

CNY 4,537.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BBF2H7
Vector pCMV6-Entry
Sequence Data
>SC332224 representing NM_001253775.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGGTGCTGGAGAGCGGGGAGCAGGGCGTGCTGCAGTGGGACCGCAAGCTGAGCGAGCTGTCAGAG
CCCGGGGACGGCGAGGCCCTCATGTACCACACGCACTTCTCAGAACTTCTGGATGAGTTTTCCCAGAAC
GTCTTGGGTCAGCTCCTGAATGATCCTTTCCTCTCAGAGAAGAGTGTGTCAATGGAGGTGGAACCTTCC
CCGACGTCCCCGGCGCCTCTCATCCAGGCTGAGCACAGCTACTCCCTGTGCGAGGAGCCTCGGGCCCAG
TCGCCCTTCACCCACATTACCACCAGTGACAGCTTCAATGACGATGAGGTGGAAAGTGAGAAATGGTAC
CTGTCTACAGACTTCCCTTCAACATCCATCAAGACAGAGCCAGTTACAGACGAACCACCCCCAGGACTC
GTTCCGTCTGTCACTCTGACCATCACAGCCATCTCCACCCCGTTGGAAAAGGAGGAACCTCCTCTGGAA
ATGAACACTGGGGTTGATTCCTCGTGCCAGACCATTATTCCTAAAATTAAGCTGGAGCCTCATGAAGTG
GATCAGTTTCTAAACTTCTCTCCTAAAGAAGGTCTGTCTGCCCTCCCTGTGTCCCTTTGGGTTATGGAT
ATGGTCTCTGGGTCTACAGAGAGGGAATATGGCGAGAGAGCTGGGATGAGTTTGTACCACAGATGTTGT
AGCTGGCTTTATGAAATAGCTCTGTTCTTAAAAAATAAAAATTTTGCTTCCAAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001253775
Insert Size 747 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001253775.1
RefSeq Size 1175 bp
RefSeq ORF 747 bp
Locus ID 64764
UniProt ID Q70SY1
Protein Families Transcription Factors
Protein Pathways Huntington's disease, Melanogenesis, Prostate cancer
MW 27.7 kDa
Gene Summary This gene encodes a member of the oasis bZIP transcription factor family. Members of this family can dimerize but form homodimers only. The encoded protein is a transcriptional activator. Translocations between this gene on chromosome 7 and the gene fused in sarcoma on chromosome 16 can be found in some tumors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (2) differs in the 3' coding region and UTR compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...