BID (NM_001244570) Human Untagged Clone
CAT#: SC332075
BID (untagged) - Homo sapiens BH3 interacting domain death agonist (BID), transcript variant 6
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
BID mouse monoclonal antibody,clone OTI1G10
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FP497 |
Vector | pCMV6-Entry |
Sequence Data |
>SC332075 representing NM_001244570.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGGAACACCAGCCGGTCG GAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTGCTGCAGGCCTACCCTAGAGACATG GAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTGCTGGCCAAGAAGGTGGCCAGTCACACGCCGTCC TTGCTCCGTGATGTCTTTCACACAACAGTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGC TTAGCCAGAAATGGGATGGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001244570 |
Insert Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001244570.1 |
RefSeq Size | 1936 bp |
RefSeq ORF | 300 bp |
Locus ID | 637 |
UniProt ID | P55957 |
Protein Families | Druggable Genome |
Protein Pathways | Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Apoptosis, Natural killer cell mediated cytotoxicity, p53 signaling pathway, Pathways in cancer, Viral myocarditis |
MW | 11.3 kDa |
Gene Summary | This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2, and thus regulate apoptosis. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Aug 2020] Transcript Variant: This variant (6) has an alternate 5' exon and uses a downstream in-frame start codon, as compared to variant 1. The encoded isoform 3 thus has a shorter N-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...