MAPKAP Kinase 3 (MAPKAPK3) (NM_001243926) Human Untagged Clone
CAT#: SC332054
MAPKAPK3 (untagged) - Homo sapiens mitogen-activated protein kinase-activated protein kinase 3 (MAPKAPK3), transcript variant 1
CNY 3,610.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 3PK; MAPKAP-K3; MAPKAP3; MAPKAPK-3; MDPT3; MK-3; MK3 |
Vector | pCMV6-Entry |
Sequence Data |
>SC332054 representing NM_001243926.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGATGGTGAAACAGCAGAGGAGCAGGGGGGCCCTGTGCCCCCGCCAGTTGCACCCGGCGGACCCGGC TTGGGCGGTGCTCCGGGGGGGCGGCGGGAGCCCAAGAAGTACGCAGTGACCGACGACTACCAGTTGTCC AAGCAGGTGCTGGGCCTGGGTGTGAACGGCAAAGTGCTGGAGTGCTTCCATCGGCGCACTGGACAGAAG TGTGCCCTGAAGCTCCTGTATGACAGCCCCAAGGCCCGGCAGGAGGTAGACCATCACTGGCAGGCTTCT GGCGGCCCCCATATTGTCTGCATCCTGGATGTGTATGAGAACATGCACCATGGCAAGCGCTGTCTCCTC ATCATCATGGAATGCATGGAAGGTGGTGAGTTGTTCAGCAGGATTCAGGAGCGTGGCGACCAGGCTTTC ACTGAGAGAGAAGCTGCAGAGATAATGCGGGATATTGGCACTGCCATCCAGTTTCTGCACAGCCATAAC ATTGCCCACCGAGATGTCAAGCCTGAAAACCTACTCTACACATCTAAGGAGAAAGACGCAGTGCTTAAG CTCACCGATTTTGGCTTTGCTAAGGAGACCACCCAAAATGCCCTGCAGACACCCTGCTATACTCCCTAT TATGTGGCCCCTGAGGTCCTGGGTCCAGAGAAGTATGACAAGTCATGTGACATGTGGTCCCTGGGTGTC ATCATGTACATCCTCCTTTGTGGCTTCCCACCCTTCTACTCCAACACGGGCCAGGCCATCTCCCCGGGG ATGAAGAGGAGGATTCGCCTGGGCCAGTACGGCTTCCCCAATCCTGAGTGGTCAGAAGTCTCTGAGGAT GCCAAGCAGCTGATCCGCCTCCTGTTGAAGACAGACCCCACAGAGAGGCTGACCATCACTCAGTTCATG AACCACCCCTGGATCAACCAATCGATGGTAGTGCCACAGACCCCACTCCACACGGCCCGAGTGCTGCAG GAGGACAAAGACCACTGGGACGAAGTCAAGGAGGAGATGACCAGTGCCTTGGCCACTATGCGGGTAGAC TACGACCAGGTGAAGATCAAGGACCTGAAGACCTCTAACAACCGGCTCCTCAACAAGAGGAGAAAAAAG CAGGCAGGCAGCTCCTCTGCCTCACAGGGCTGCAACAACCAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243926 |
Insert Size | 1149 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001243926.1 |
RefSeq Size | 3047 bp |
RefSeq ORF | 1149 bp |
Locus ID | 7867 |
UniProt ID | Q16644 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | MAPK signaling pathway, VEGF signaling pathway |
MW | 43 kDa |
Gene Summary | This gene encodes a member of the Ser/Thr protein kinase family. This kinase functions as a mitogen-activated protein kinase (MAP kinase)- activated protein kinase. MAP kinases are also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This kinase was shown to be activated by growth inducers and stress stimulation of cells. In vitro studies demonstrated that ERK, p38 MAP kinase and Jun N-terminal kinase were all able to phosphorylate and activate this kinase, which suggested the role of this kinase as an integrative element of signaling in both mitogen and stress responses. This kinase was reported to interact with, phosphorylate and repress the activity of E47, which is a basic helix-loop-helix transcription factor known to be involved in the regulation of tissue-specific gene expression and cell differentiation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233934 | MAPKAPK3 (Myc-DDK tagged) - Homo sapiens mitogen-activated protein kinase-activated protein kinase 3 (MAPKAPK3), transcript variant 1 |
CNY 3,656.00 |
|
RG233934 | MAPKAPK3 (tGFP-tagged) - Homo sapiens mitogen-activated protein kinase-activated protein kinase 3 (MAPKAPK3), transcript variant 1 |
CNY 4,370.00 |
其它MAPKAP Kinase 3产品