FHL3 (NM_001243878) Human Untagged Clone

CAT#: SC332050

FHL3 (untagged) - Homo sapiens four and a half LIM domains 3 (FHL3), transcript variant 2



  "NM_001243878" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-FHL3 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SLIM2
Vector pCMV6-Entry
Sequence Data
>SC332050 representing NM_001243878.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCTGGGTCCCGGAAGCTGGAATATGGAGGCCAGACATGGCATGAGCACTGCTTCCTGTGCAGTGGC
TGTGAACAGCCACTGGGCTCCCGTTCTTTTGTGCCCGACAAGGGTGCTCACTACTGCGTGCCCTGCTAT
GAGAACAAGTTTGCTCCTCGCTGCGCCCGCTGCAGCAAGACGCTGACACAGGGTGGAGTGACATACCGT
GATCAGCCGTGGCATCGAGAATGTCTGGTCTGTACCGGATGCCAGACGCCCCTGGCAGGGCAGCAGTTC
ACCTCCCGGGATGAAGATCCCTACTGTGTGGCCTGTTTTGGAGAACTCTTTGCACCTAAGTGCAGCAGC
TGCAAGCGCCCCATCGTAGGACTCGGTGGAGGCAAGTATGTGTCCTTTGAAGACCGACACTGGCACCAC
AACTGCTTCTCCTGCGCCCGCTGCTCTACCTCCCTGGTGGGCCAGGGCTTCGTACCGGATGGAGACCAA
GTGCTCTGCCAGGGCTGTAGCCAGGCAGGGCCCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001243878
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243878.1
RefSeq Size 1486 bp
RefSeq ORF 519 bp
Locus ID 2275
UniProt ID Q13643
MW 18.9 kDa
Gene Summary The protein encoded by this gene is a member of a family of proteins containing a four-and-a-half LIM domain, which is a highly conserved double zinc finger motif. The encoded protein has been shown to interact with the cancer developmental regulators SMAD2, SMAD3, and SMAD4, the skeletal muscle myogenesis protein MyoD, and the high-affinity IgE beta chain regulator MZF-1. This protein may be involved in tumor suppression, repression of MyoD expression, and repression of IgE receptor expression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...