ZC4H2 (NM_001243804) Human Untagged Clone

CAT#: SC332046

ZC4H2 (untagged) - Homo sapiens zinc finger, C4H2 domain containing (ZC4H2), transcript variant 4



  "NM_001243804" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HCA127; KIAA1166; MCS; MRXS4; WRWF; WRWFFR; WWS
Vector pCMV6-Entry
Sequence Data
>SC332046 representing NM_001243804.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGAAGATCAAGGCTCGTTTGAAGGCTGAGTTTGAGGCACTTGAGTCAGAGGAAAGGCACCTGAAG
GAATACAAGCAGGAGATGGACCTTCTGCTACAGGAGAAGATGGCCCATGTGGAGGAACTCCGACTGATC
CACGCTGACATCAATGTGATGGAAAACACTATCAAACAATCTGAGAATGACCTAAACAAGCTGCTAGAG
TCTACAAGGAGGCTGCATGATGAGTATAAGCCACTGAAAGAACATGTGGATGCCCTGCGCATGACTCTG
GGCCTGCAGAGGCTCCCTGACTTGTGTGAAGAAGAGGAGAAGCTTTCCTTGGATTACTTTGAGAAGCAG
AAAGCAGAATGGCAGACAGAACCTCAGGAGCCCCCCATCCCTGAGTCCCTGGCCGCTGCAGCCGCTGCC
GCCCAACAGCTCCAAGTGGCTAGGAAGCAGGATACTCGGCAGACGGCCACCTTCAGGCAGCAGCCCCCA
CCTATGAAGGCCTGCTTGTCATGTCACCAGCAAATTCACCGGAATGCACCTATATGCCCTCTTTGCAAG
GCCAAGAGTCGGTCCCGGAACCCCAAAAAGCCGAAACGGAAGCAGGATGAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001243804
Insert Size 606 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243804.1
RefSeq Size 2719 bp
RefSeq ORF 606 bp
Locus ID 55906
UniProt ID Q9NQZ6
MW 23.5 kDa
Gene Summary This gene encodes a member of the zinc finger domain-containing protein family. This family member has a C-terminal zinc finger domain that is characterized by four cysteine residues and two histidine residues, and it also includes a coiled-coil region. This protein has been detected as an autoantigen in hepatocellular carcinoma patients. This gene has been identified as a potential candidate for X-linked cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Both variants 2 and 4 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...