RAG2 (NM_001243786) Human Untagged Clone

CAT#: SC332040

RAG2 (untagged) - Homo sapiens recombination activating gene 2 (RAG2), transcript variant 4



  "NM_001243786" in other vectors (2)

CNY 5,130.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to RAG2 (recombination activating gene 2)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RAG-2
Vector pCMV6-Entry
Sequence Data
>SC332040 representing NM_001243786.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTCTGCAGATGGTAACAGTCAGTAATAACATAGCCTTAATTCAGCCAGGCTTCTCACTGATGAAT
TTTGATGGACAAGTTTTCTTCTTTGGACAAAAAGGCTGGCCCAAAAGATCCTGCCCCACTGGAGTTTTC
CATCTGGATGTAAAGCATAACCATGTCAAACTGAAGCCTACAATTTTCTCTAAGGATTCCTGCTACCTC
CCTCCTCTTCGCTACCCAGCCACTTGCACATTCAAAGGCAGCTTGGAGTCTGAAAAGCATCAATACATC
ATCCATGGAGGGAAAACACCAAACAATGAGGTTTCAGATAAGATTTATGTCATGTCTATTGTTTGCAAG
AACAACAAAAAGGTTACTTTTCGCTGCACAGAGAAAGACTTGGTAGGAGATGTTCCTGAAGCCAGATAT
GGTCATTCCATTAATGTGGTGTACAGCCGAGGGAAAAGTATGGGTGTTCTCTTTGGAGGACGCTCATAC
ATGCCTTCTACCCACAGAACCACAGAAAAATGGAATAGTGTAGCTGACTGCCTGCCCTGTGTTTTCCTG
GTGGATTTTGAATTTGGGTGTGCTACATCATACATTCTTCCAGAACTTCAGGATGGGCTATCTTTTCAT
GTCTCTATTGCCAAAAATGACACCATCTATATTTTAGGAGGACATTCACTTGCCAATAATATCCGGCCT
GCCAACCTGTACAGAATAAGGGTTGATCTTCCCCTGGGTAGCCCAGCTGTGAATTGCACAGTCTTGCCA
GGAGGAATCTCTGTCTCCAGTGCAATCCTGACTCAAACTAACAATGATGAATTTGTTATTGTTGGTGGC
TATCAGCTTGAAAATCAAAAAAGAATGATCTGCAACATCATCTCTTTAGAGGACAACAAGATAGAAATT
CGTGAGATGGAGACCCCAGATTGGACCCCAGACATTAAGCACAGCAAGATATGGTTTGGAAGCAACATG
GGAAATGGAACTGTTTTTCTTGGCATACCAGGAGACAATAAACAAGTTGTTTCAGAAGGATTCTATTTC
TATATGTTGAAATGTGCTGAAGATGATACTAATGAAGAGCAGACAACATTCACAAACAGTCAAACATCA
ACAGAAGATCCAGGGGATTCCACTCCCTTTGAAGACTCTGAAGAATTTTGTTTCAGTGCAGAAGCAAAT
AGTTTTGATGGTGATGATGAATTTGACACCTATAATGAAGATGATGAAGAAGATGAGTCTGAGACAGGC
TACTGGATTACATGCTGCCCTACTTGTGATGTGGATATCAACACTTGGGTACCATTCTATTCAACTGAG
CTCAACAAACCCGCCATGATCTACTGCTCTCATGGGGATGGGCACTGGGTCCATGCTCAGTGCATGGAT
CTGGCAGAACGCACACTCATCCATCTGTCAGCAGGAAGCAACAAGTATTACTGCAATGAGCATGTGGAG
ATAGCAAGAGCTCTACACACTCCCCAAAGAGTCCTACCCTTAAAAAAGCCTCCAATGAAATCCCTCCGT
AAAAAAGGTTCTGGAAAAATCTTGACTCCTGCCAAGAAATCCTTTCTTAGAAGGTTGTTTGATTAG

Restriction Sites SgfI-MluI     
ACCN NM_001243786
Insert Size 1584 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243786.1
RefSeq Size 2846 bp
RefSeq ORF 1584 bp
Locus ID 5897
UniProt ID P55895
Protein Families Druggable Genome
Protein Pathways Primary immunodeficiency
MW 59.2 kDa
Gene Summary This gene encodes a protein that is involved in the initiation of V(D)J recombination during B and T cell development. This protein forms a complex with the product of the adjacent recombination activating gene 1, and this complex can form double-strand breaks by cleaving DNA at conserved recombination signal sequences. The recombination activating gene 1 component is thought to contain most of the catalytic activity, while the N-terminal of the recombination activating gene 2 component is thought to form a six-bladed propeller in the active core that serves as a binding scaffold for the tight association of the complex with DNA. A C-terminal plant homeodomain finger-like motif in this protein is necessary for interactions with chromatin components, specifically with histone H3 that is trimethylated at lysine 4. Mutations in this gene cause Omenn syndrome, a form of severe combined immunodeficiency associated with autoimmune-like symptoms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) includes an alternate exon in the 5' UTR compared to variant 1. Variants 1, 3 and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...