CEP57 (NM_001243777) Human Untagged Clone

CAT#: SC332037

CEP57 (untagged) - Homo sapiens centrosomal protein 57kDa (CEP57), transcript variant 3



  "NM_001243777" in other vectors (2)

CNY 4,560.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CEP57 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MVA2; PIG8; TSP57
Vector pCMV6-Entry
Sequence Data
>SC332037 representing NM_001243777.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGCGGCGTCTGTCTCTGCGGCTTCTGGTTCTCACTTGTCGAACAGCTTTGCTGAGCCATCAAGG
TCTAATGGAAGCATGGTTCGGCATTCTTCATCTCCATATGTAGTATATCCTTCGGATAAGCCTTTCCTT
AATAGTGATCTACGACGCTCCCCAAGTAAGCCTACACTTGCCTATCCAGAAAGCAACAGCAGAGCCATA
TTTTCTGCTCTTAAGAATCTTCAAGATAAGATTCGACGCTTGGAACTTGAGAGGATTCAGGCAGAAGAA
AGTGTGAAAACCTTGTCTAGAGAAACAATTGAATATAAGAAAGTACTGGATGAACAGATACAAGAAAGG
GAGAATTCAAAGAATGAGGAATCAAAGCACAATCAAGAACTGACATCTCAGTTGTTAGCTGCAGAAAAT
AAATGCAATCTATTAGAAAAACAATTGGAATACATGCGAAATATGATAAAGCATGCCGAAATGGAGAGG
ACATCTGTCTTAGAGAAACAAGTTTCCCTAGAAAGAGAACGACAACATGATCAAACACATGTTCAGAGC
CAACTTGAAAAATTGGATCTTCTTGAACAGGAGTATAACAAACTTACCACAATGCAGGCCCTTGCAGAA
AAAAAAATGCAAGAGTTGGAAGCAAAACTCCATGAAGAAGAACAGGAAAGGAAACGCATGCAAGCTAAG
GCAGCTGAGTTGCAGACTGGTCTAGAAACAAATAGACTTATCTTTGAAGATAAGGCAACTCCGTGTGTT
CCCAATGCAAGAAGAATTAAAAAAAAGAAGTCAAAACCACCAGAAAAGTCCACAAGCCCTAGCCATGCC
GTGGTAGCCAATGTTCAGCTTGTCTTGCATCTAATGAAGCAACACAGTAAAGCTTTGTGCAATGATCGA
GTCATCAACAGTATTCCTTTGGCAAAGCAAGTATCTTCACGAGGTGGTAAAAGTAAGAAGTTGTCAGTA
ACACCTCCCTCCTCCAACGGTATTAATGAGGAGTTGTCAGAAGTCTTACAGACTTTACAGGATGAATTT
GGGCAAATGAGCTTTGATCACCAGCAGCTTGCAAAACTTATCCAGGAGTCGCCAACCGTTGAACTGAAA
GACAAGTTGGAGTGTGAATTGGAGGCATTAGTGGGAAGGATGGAAGCAAAAGCCAACCAAATAACTAAA
GTTCGAAAATACCAAGCCCAGCTGGAGAAACAGAAGTTAGAGAAGCAGAAGAAGGAATTAAAAGCTACC
AAAAAGACTCTTGATGAAGAAAGAAACAGCAGCAGCCGTTCTGGAATCACAGGGACCACAAATAAGAAA
GATTTTATGAAACTGAGACCTGGAGAAAAAAGGAGAAAAAATCTTCAGTTATTGAAGGACATGCAAAGC
ATACAGAATTCATTACAAAGCAGTAGTTTGTGTTGGGATTACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243777
Insert Size 1425 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243777.1
RefSeq Size 3114 bp
RefSeq ORF 1425 bp
Locus ID 9702
UniProt ID Q86XR8
MW 54.2 kDa
Gene Summary This gene encodes a cytoplasmic protein called Translokin. This protein localizes to the centrosome and has a function in microtubular stabilization. The N-terminal half of this protein is required for its centrosome localization and for its multimerization, and the C-terminal half is required for nucleating, bundling and anchoring microtubules to the centrosomes. This protein specifically interacts with fibroblast growth factor 2 (FGF2), sorting nexin 6, Ran-binding protein M and the kinesins KIF3A and KIF3B, and thus mediates the nuclear translocation and mitogenic activity of the FGF2. It also interacts with cyclin D1 and controls nucleocytoplasmic distribution of the cyclin D1 in quiescent cells. This protein is crucial for maintaining correct chromosomal number during cell division. Mutations in this gene cause mosaic variegated aneuploidy syndrome, a rare autosomal recessive disorder. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) lacks an in-frame exon in the 3' coding region, compared to variant 1. The resulting isoform (c) lacks an internal segment, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...