VEGFB (NM_001243733) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	VEGFL; VRF
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC332025 representing NM_001243733. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGCCCTCTGCTCCGCCGCCTGCTGCTCGCCGCACTCCTGCAGCTGGCCCCCGCCCAGGCCCCTGTC TCCCAGCCTGATGCCCCTGGCCACCAGAGGAAAGTGGTGTCATGGATAGATGTGTATACTCGCGCTACC TGCCAGCCCCGGGAGGTGGTGGTGCCCTTGACTGTGGAGCTCATGGGCACCGTGGCCAAACAGCTGGTG CCCAGCTGCGTGACTGTGCAGCGCTGTGGTGGCTGCTGCCCTGACGATGGCCTGGAGTGTGTGCCCACT GGGCAGCACCAAGTCCGGATGCAGATCCTCATGATCCGGTACCCGAGCAGTCAGCTGGGGGAGATGTCC CTGGAAGAACACAGCCAGTGTGAATGCAGACCTAAAAAAAAGGACAGTGCTGTGAAGCCAGACAGCCCC AGGCCCCTCTGCCCACGCTGCACCCAGCACCACCAGCGCCCTGACCCCCGGACCTGCCGCTGCCGCTGC CGACGCCGCAGCTTCCTCCGTTGCCAAGGGCGGGGCTTAGAGCTCAACCCAGACACCTGCAGGTGCCGG AAGCTGCGAAGGTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001243733
Insert Size	567 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001243733.1
RefSeq Size	1721 bp
RefSeq ORF	567 bp
Locus ID	7423
UniProt ID	P49765
Protein Families	Druggable Genome, Secreted Protein
Protein Pathways	Bladder cancer, Cytokine-cytokine receptor interaction, Focal adhesion, mTOR signaling pathway, Pancreatic cancer, Pathways in cancer, Renal cell carcinoma
MW	21.3 kDa
Gene Summary	This gene encodes a member of the PDGF (platelet-derived growth factor)/VEGF (vascular endothelial growth factor) family. The VEGF family members regulate the formation of blood vessels and are involved in endothelial cell physiology. This member is a ligand for VEGFR-1 (vascular endothelial growth factor receptor 1) and NRP-1 (neuropilin-1). Studies in mice showed that this gene was co-expressed with nuclear-encoded mitochondrial genes and the encoded protein specifically controlled endothelial uptake of fatty acids. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (VEGFB-167) lacks a segment in the 3' coding region, resulting in a downstream stop codon, compared to variant VEGFB-186. The resulting isoform (VEGFB-167, also known as VRF167) has a shorter and distinct C-terminus, compared to isoform VEGFB-186. This isoform contains the heparin binding domain and is mostly sequestered in the extracellular matrix. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.