Retinoic Acid Receptor gamma (RARG) (NM_001243730) Human Untagged Clone

CAT#: SC332022

RARG (untagged) - Homo sapiens retinoic acid receptor, gamma (RARG), transcript variant 4



  "NM_001243730" in other vectors (2)

CNY 3,610.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
RARG mouse monoclonal antibody, clone OTI3G1. This antibody can recognize both RARG isoform 1 (NM_000966) and isoform 2 (NM_001042728)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NR1B3; RARC
Vector pCMV6-Entry
Sequence Data
>SC332022 representing NM_001243730.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGCCCAGCTCGCCCTCGCCCCCTCCGCCTCCTCGGGTCTACAAGCCATGCTTCGTGTGCAATGAC
AAGTCCTCTGGCTACCACTATGGGGTCAGCTCTTGTGAAGGCTGCAAGGGCTTCTTTCGCCGAAGCATC
CAGAAGAACATGGTGTACACGTGTCACCGCGACAAAAACTGTATCATCAACAAGGTGACCAGGAATCGC
TGCCAGTACTGCCGGCTACAGAAGTGCTTCGAAGTGGGCATGTCCAAGGAAGCTGTGCGAAATGACCGG
AACAAGAAGAAGAAAGAGGTGAAGGAAGAAGGGTCACCTGACAGCTATGAGCTGAGCCCTCAGTTAGAA
GAGCTCATCACCAAGGTCAGCAAAGCCCATCAGGAGACTTTCCCCTCGCTCTGCCAGCTGGGCAAGTAT
ACCACGAACTCCAGTGCAGACCACCGCGTGCAGCTGGATCTGGGGCTGTGGGACAAGTTCAGTGAGCTG
GCTACCAAGTGCATCATCAAGATCGTGGAGTTTGCCAAGCGGTTGCCTGGCTTTACAGGGCTCAGCATT
GCTGACCAGATCACTCTGCTCAAAGCTGCCTGCCTAGATATCCTGATGCTGCGTATCTGCACAAGGTAC
ACCCCAGAGCAGGACACCATGACCTTCTCCGACGGGCTGACCCTGAACCGGACCCAGATGCACAATGCC
GGCTTCGGGCCCCTCACAGACCTTGTCTTTGCCTTTGCTGGGCAGCTCCTGCCCCTGGAGATGGATGAC
ACCGAGACAGGGCTGCTCAGCGCCATCTGCCTCATCTGCGGAGACCGCATGGACCTGGAGGAGCCCGAA
AAAGTGGACAAGCTGCAGGAGCCACTGCTGGAAGCCCTGAGGCTGTACGCCCGGCGCCGGCGGCCCAGC
CAGCCCTACATGTTCCCAAGGATGCTAATGAAAATCACCGACCTCCGGGGCATCAGCACTAAGGGAGCT
GAAAGGGCCATTACTCTGAAGATGGAGATTCCAGGCCCGATGCCTCCCTTAATCCGAGAGATGCTGGAG
AACCCTGAAATGTTTGAGGATGACTCCTCGCAGCCTGGTCCCCACCCCAATGCCTCTAGCGAGGATGAG
GTTCCTGGGGGCCAGGGCAAAGGGGGCCTGAAGTCCCCAGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243730
Insert Size 1149 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243730.1
RefSeq Size 2666 bp
RefSeq ORF 1149 bp
Locus ID 5916
UniProt ID P13631
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
MW 42.9 kDa
Gene Summary This gene encodes a retinoic acid receptor that belongs to the nuclear hormone receptor family. Retinoic acid receptors (RARs) act as ligand-dependent transcriptional regulators. When bound to ligands, RARs activate transcription by binding as heterodimers to the retinoic acid response elements (RARE) found in the promoter regions of the target genes. In their unbound form, RARs repress transcription of their target genes. RARs are involved in various biological processes, including limb bud development, skeletal growth, and matrix homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (4) lacks an exon containing the start codon used in variant 1. This results in translation initiation from an in-frame downstream AUG, and an isoform (4) with a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Retinoic Acid Receptor gamma产品

Customer Reviews 
Loading...