CD2BP2 (NM_001243646) Human Untagged Clone

CAT#: SC332014

CD2BP2 (untagged) - Homo sapiens CD2 (cytoplasmic tail) binding protein 2 (CD2BP2), transcript variant 2



  "NM_001243646" in other vectors (2)

CNY 3,330.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Goat Polyclonal Antibody against CD2BP2
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FWP010; LIN1; PPP1R59; Snu40; U5-52K
Vector pCMV6-Entry
Sequence Data
>SC332014 representing NM_001243646.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCAAAGAGGAAAGTGACCTTCCAAGGCGTGGGAGATGAGGAGGATGAGGATGAAATCATTGTCCCC
AAGAAGAAGCTGGTGGACCCTGTGGCTGGGTCAGGGGGTCCTGGGAGCCGCTTTAAAGGCAAACACTCT
TTGGATAGCGATGAGGAGGAGGATGATGATGATGGGGGGTCCAGCAAATATGACATCTTGGCCTCAGAG
GATGTAGAAGGTCAGGAGGCAGCCACACTCCCCAGCGAGGGGGGTGTTCGGATCACACCCTTTAACCTG
CAGGAGGAGATGGAGGAAGGCCACTTTGATGCCGATGGCAACTACTTCCTGAACCGGGATGCTCAGATC
CGAGACAGCTGGCTGGACAACATTGACTGGGTGAAGATCCGGGAGCGGCCACCTGGCCAGCGCCAGGCC
TCAGACTCGGAGGAGGAGGACAGCTTGGGCCAGACCTCAATGAGTGCCCAAGCCCTCTTGGAGGGACTT
TTGGAGCTCCTATTGCCTAGAGAGACAGTGGCTGGGGCACTGAGGCGTCTGGGGGCCCGAGGAGGAGGC
AAAGGGAGAAAGGGGCCTGGGCAACCCAGTTCCCCTCAGCGCCTGGACCGGCTCTCCGGGTTGGCCGAC
CAGATGGTGGCCCGGGGCAACCTTGGTGTGTACCAGGAAACAAGGGAACGGTTGGCTATGCGTCTGAAG
GGTTTGGGGTGTCAGACCCTAGGACCCCACAATCCCACACCCCCACCCTCCCTGGACATGTTCGCTGAG
GAGTTGGCGGAGGAGGAACTGGAGACCCCAACCCCTACCCAGAGAGGAGAAGCAGAGTCGCGGGGAGAT
GGTCTGGTGGATGTGATGTGGGAATATAAGTGGGAGAACACGGGGGATGCCGAGCTGTATGGGCCCTTC
ACCAGCGCCCAGATGCAGACCTGGGTGAGTGAAGGCTACTTCCCGGACGGTGTTTATTGCCGGAAGCTG
GACCCCCCTGGTGGTCAGTTCTACAACTCCAAACGCATTGACTTTGACCTCTACACCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243646
Insert Size 1026 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243646.1
RefSeq Size 3513 bp
RefSeq ORF 1026 bp
Locus ID 10421
UniProt ID O95400
MW 37.6 kDa
Gene Summary This gene encodes a bi-functional protein. In the cytoplasm, the encoded protein binds the cytoplasmic tail of human surface antigen CD2 via its C-terminal GYF domain, and regulate CD2-triggered T lymphocyte activation. In the nucleus, this protein is a component of the U5 small nuclear ribonucleoprotein complex and is involved in RNA splicing. A pseudogene has been identified on chromosome 7. Alternative splicing results in multiple transcript variants but their biological validity has not been determined. [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...