KIF13A (NM_001243423) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	bA500C11.2; RBKIN
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC332000 representing NM_001243423. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCGGATACCAAGGTAAAAGTTGCCGTCCGGGTCCGGCCCATGAACCGACGAGAACTGGAACTGAAC ACCAAGTGCGTGGTGGAGATGGAAGGGAATCAAACGGTCCTGCACCCTCCTCCTTCTAACACCAAACAG GGAGAAAGGCTGGTCACAGTGGCTCACATCTCTAATTCCAGCACTTTGGGAGGCCAAGGCAAGAGGATC ACTTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001243423
Insert Size	213 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001243423.1
RefSeq Size	1340 bp
RefSeq ORF	213 bp
Locus ID	63971
UniProt ID	Q9H1H9
Protein Families	Druggable Genome
MW	7.7 kDa
Gene Summary	This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (5) lacks several 3' exons but includes an alternate 3' exon, and thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (e) shares the same N-terminus but has a distinct C-terminus and is significantly shorter than isoform a.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.