MS4A4A (NM_001243266) Human Untagged Clone
CAT#: SC331985
MS4A4A (untagged) - Homo sapiens membrane-spanning 4-domains, subfamily A, member 4A (MS4A4A), transcript variant 3
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 4SPAN1; CD20-L1; CD20L1; HDCME31P; MS4A4; MS4A7 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331985 representing NM_001243266.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCATCAGACCTACAGCAGACATTGCAGGCCTGAAGAAAGCACCTTTTCTGCTGCCATGACAACCATG CAAGGAATGGAACAGGCCATGCCAGGGGCTGGCCCTGGTGTGCCCCAGCTGGGAAACATGGCTGTCATA CATTCACATCTGTGGAAAGGATTGCAAGAGAAGTTCTTGAAGGGAGAACCCAAAGTCCTTGGGGTTGTG CAGATTCTGACTGCCCTGATGAGCCTTAGCATGGGAATAACAATGATGTGTATGGCATCTAATACTTAT GGAAGTAACCCTATTTCCGTGTATATCGGGTACACAATTTGGGGGTCAGTAATGTTTATTATTTCAGGA TCCTTGTCAATTGCAGCAGGAATTAGAACTACAAAAGGCCTGGGTCTGGATGGCATGGTGCTCCTCTTA AGTGTGCTGGAATTCTGCATTGCTGTGTCCCTCTCTGCCTTTGGATGTAAAGTGCTCTGTTGTACCCCT GGTGGGGTTGTGTTAATTCTGCCATCACATTCTCACATGGCAGAAACAGCATCTCCCACACCACTTAAT GAGGTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243266 |
Insert Size | 561 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243266.1 |
RefSeq Size | 1509 bp |
RefSeq ORF | 561 bp |
Locus ID | 51338 |
UniProt ID | Q96JQ5 |
Protein Families | Druggable Genome, Transmembrane |
MW | 19.7 kDa |
Gene Summary | This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features, similar intron/exon splice boundaries, and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (3) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (3) missing an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233387 | MS4A4A (Myc-DDK tagged) - Homo sapiens membrane-spanning 4-domains, subfamily A, member 4A (MS4A4A), transcript variant 3 |
CNY 3,990.00 |
|
RG233387 | MS4A4A (tGFP-tagged) - Homo sapiens membrane-spanning 4-domains, subfamily A, member 4A (MS4A4A), transcript variant 3 |
CNY 4,240.00 |