MS4A4A (NM_001243266) Human Untagged Clone

CAT#: SC331985

MS4A4A (untagged) - Homo sapiens membrane-spanning 4-domains, subfamily A, member 4A (MS4A4A), transcript variant 3



  "NM_001243266" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MS4A4A Antibody - N-terminal region
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 4SPAN1; CD20-L1; CD20L1; HDCME31P; MS4A4; MS4A7
Vector pCMV6-Entry
Sequence Data
>SC331985 representing NM_001243266.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCATCAGACCTACAGCAGACATTGCAGGCCTGAAGAAAGCACCTTTTCTGCTGCCATGACAACCATG
CAAGGAATGGAACAGGCCATGCCAGGGGCTGGCCCTGGTGTGCCCCAGCTGGGAAACATGGCTGTCATA
CATTCACATCTGTGGAAAGGATTGCAAGAGAAGTTCTTGAAGGGAGAACCCAAAGTCCTTGGGGTTGTG
CAGATTCTGACTGCCCTGATGAGCCTTAGCATGGGAATAACAATGATGTGTATGGCATCTAATACTTAT
GGAAGTAACCCTATTTCCGTGTATATCGGGTACACAATTTGGGGGTCAGTAATGTTTATTATTTCAGGA
TCCTTGTCAATTGCAGCAGGAATTAGAACTACAAAAGGCCTGGGTCTGGATGGCATGGTGCTCCTCTTA
AGTGTGCTGGAATTCTGCATTGCTGTGTCCCTCTCTGCCTTTGGATGTAAAGTGCTCTGTTGTACCCCT
GGTGGGGTTGTGTTAATTCTGCCATCACATTCTCACATGGCAGAAACAGCATCTCCCACACCACTTAAT
GAGGTTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243266
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243266.1
RefSeq Size 1509 bp
RefSeq ORF 561 bp
Locus ID 51338
UniProt ID Q96JQ5
Protein Families Druggable Genome, Transmembrane
MW 19.7 kDa
Gene Summary This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features, similar intron/exon splice boundaries, and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (3) missing an internal protein segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...