PTCRA (NM_001243169) Human Untagged Clone

CAT#: SC331963

PTCRA (untagged) - Homo sapiens pre T-cell antigen receptor alpha (PTCRA), transcript variant 3



  "NM_001243169" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PTCRA Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PT-ALPHA; PTA
Vector pCMV6-Entry
Sequence Data
>SC331963 representing NM_001243169.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCGGTACATGGCTGCTACTTCTCCTGGCCCTTGGGTGTCCAGCCCTACCCACAGGTCCTGTTTCC
TTCCCTTCCTCACCAGAGGCTGCCACAACAGGCCCCATCTGGTTCTCAGCCGGCAATGGCAGTGCACTG
GATGCCTTCACCTATGGCCCTTCCCCAGCAACGGATGGCACCTGGACCAACTTGGCCCATCTCTCCCTG
CCTTCTGAGGAGCTGGCATCCTGGGAGCCTTTGGTCTGCCACACTGGGCCTGGGGCTGAGGGTCACAGC
AGGAGTACACAGCCCATGCATCTGTCAGGAGAGGCTTCTACAGCCAGGACCTGCCCCCAGGAGCCTCTC
AGGGGGACACCGGGTGGGGCGCTGTGGCTGGGGGTCCTGCGGCTGCTGCTCTTCAAGCTGCTGCTGTTT
GACCTGCTCCTGACCTGCAGCTGCCTGTGCGACCCCGCGGGCCCGCTGCCTTCCCCCGCAACCACCACC
CGCCTGCGAGCCCTCGGCTCCCATCGACTGCACCCGGCCACGGAGACTGGGGGACGAGAGGCCACCAGC
TCACCCAGACCCCAGCCTCGGGACCGCCGCTGGGGTGACACCCCTCCGGGTCGGAAGCCCGGGAGCCCA
GTATGGGGGGAAGGGTCTTACCTCAGCAGTTACCCCACTTGCCCAGCACAGGCCTGGTGCTCAAGATCT
GCCCTCAGGGCTCCTTCCTCCAGTCTTGGAGCATTTTTTGCAGGTGACCTGCCTCCTCCTCTGCAGGCT
GGAGCTGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243169
Insert Size 771 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243169.1
RefSeq Size 1022 bp
RefSeq ORF 771 bp
Locus ID 171558
UniProt ID Q6ISU1
Protein Families Transmembrane
Protein Pathways Notch signaling pathway
MW 26.6 kDa
Gene Summary The protein encoded by this gene is a single-pass type I membrane protein that is found in immmature but not mature T-cells. Along with TCRB and CD3 complex, the encoded protein forms the pre-T-cell receptor complex, which regulates early T-cell development. Four transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
Transcript Variant: This variant (3) uses alternate in-frame splice junctions at the 5' ends of two exons and contains an alternate in-frame exon compared to variant 1. The resulting isoform (3) contains an alternate internal segment but lacks two others compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...