CD23 (FCER2) (NM_001207019) Human Untagged Clone
CAT#: SC331740
FCER2 (untagged) - Homo sapiens Fc fragment of IgE, low affinity II, receptor for (CD23) (FCER2), transcript variant 2
CNY 3,140.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BLAST-2; CD23; CD23A; CLEC4J; FCE2; IGEBF |
Vector | pCMV6-Entry |
Sequence Data |
>SC331740 representing NM_001207019.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAATCCTCCAAGCCAGGAGATCGAGGAGCTTCCCAGGAGGCGGTGTTGCAGGCGTGGGACTCAGATC GTGCTGCTGGGGCTGGTGACCGCCGCTCTGTGGGCTGGGCTGCTGACTCTGCTTCTCCTGTGGCACTGG GACACCACACAGAGTCTAAAACAGCTGGAAGAGAGGGCTGCCCGGAACGTCTCTCAAGTTTCCAAGAAC TTGGAAAGCCACCACGGTGACCAGATGGCGCAGAAATCCCAGTCCACGCAGATTTCACAGGAACTGGAG GAACTTCGAGCTGAACAGCAGAGATTGAAATCTCAGGACTTGGAGCTGTCCTGGAACCTGAACGGGCTT CAAGCAGATCTGAGCAGCTTCAAGTCCCAGGAATTGAACGAGAGGAACGAAGCTTCAGATTTGCTGGAA AGACTCCGGGAGGAGGTGACAAAGCTAAGGATGGAGTTGCAGGTGTCCAGCGGCTTTGTGTGCAACACG TGCCCTGAAAAGTGGATCAATTTCCAACGGAAGTGCTACTACTTCGGCAAGGGCACCAAGCAGTGGGTC CACGCCCGGTATGCCTGTGACGACATGGAAGGGCAGCTGGTCAGCATCCACAGCCCGGAGGAGCAGGAC TTCCTGACCAAGCATGCCAGCCACACCGGCTCCTGGATTGGCCTTCGGAACTTGGACCTGAAGGGGGAG TTTATCTGGGTGGATGGGAGCCACGTGGACTACAGCAACTGGGCTCCAGGGGAGCCCACCAGCCGGAGC CAGGGCGAGGACTGCGTGATGATGCGGGGCTCCGGTCGCTGGAACGACGCCTTCTGCGACCGTAAGCTG GGCGCCTGGGTGTGCGACCGGCTGGCCACATGCACGCCGCCAGCCAGCGAAGGTTCCGCGGAGTCCATG GGACCTGATTCAAGACCAGACCCTGACGGCCGCCTGCCCACCCCCTCTGCCCCTCTCCACTCTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001207019 |
Insert Size | 963 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001207019.2 |
RefSeq Size | 1488 bp |
RefSeq ORF | 963 bp |
Locus ID | 2208 |
UniProt ID | P06734 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | Hematopoietic cell lineage |
MW | 36.3 kDa |
Gene Summary | The protein encoded by this gene is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011] Transcript Variant: This variant (2) contains an alternate 5' terminal exon and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (b, also known as CD23b) is shorter and has a distinct N-terminus, compared to isoform a. This variant is supported by data in PubMed IDs 12379312 and 15843555. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233748 | FCER2 (Myc-DDK tagged) - Homo sapiens Fc fragment of IgE, low affinity II, receptor for (CD23) (FCER2), transcript variant 2 |
CNY 3,990.00 |
|
RG233748 | FCER2 (tGFP-tagged) - Homo sapiens Fc fragment of IgE, low affinity II, receptor for (CD23) (FCER2), transcript variant 2 |
CNY 4,370.00 |