RIC3 (NM_001206671) Human Untagged Clone

CAT#: SC331669

RIC3 (untagged) - Homo sapiens RIC3 acetylcholine receptor chaperone (RIC3), transcript variant 3



  "NM_001206671" in other vectors (2)

CNY 3,520.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RIC3 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AYST720; PRO1385
Vector pCMV6-Entry
Sequence Data
>SC331669 representing NM_001206671.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGTACTCCACAGTGCAGAGAGTCGCTCTGGCTTCTGGGCTTGTCCTGGCTCTGTCGCTGCTGCTG
CCCAAGGCCTTCCTGTCCCGCGGGAAGCGGCAGGAGCCGCCGCCGACACCTGAAGGAAAATTGGGCCGA
TTTCCACCTATGATGCATCATCACCAGGCACCCTCAGATGGCCAGACTCCTGGGGCTCGTTTCCAGAGG
TCTCACCTTGCCGAGGCATTTGCAAAGGCCAAAGGATCAGGTGGAGGTGCTGGAGGAGGAGGTAGTGGA
AGAGGTCTGATGGGGCAGATTATTCCAATCTACGGTTTTGGGATTTTTTTATATATACTGTACATTCTA
TTTAAGCTCTCAAAGGGGAAAACAACTGCAGAGGATGGGAAATGCTATACTGCCATGCCTGGAAACACC
CACAGGAAAATTACCAGTTTTGAGCTTGCTCAACTGCAAGAAAAACTGAAGGAGACAGAAGCAGCCATG
GAAAAATTAATCAACAGAGTGGGACCTAATGGTGAGAGCAGAGCACAGACTGTGACTTCTGACCAAGAG
AAACGGTTGCTACATCAGCTCCGAGAAATCACCAGGGTCATGAAAGAAGGAAAATTCATTGACAGATTT
TCTCCAGAGAAAGAAGCTGAGGAGGCCCCTTACATGGAGGACTGGGAAGGTTACCCTGAAGAGACTTAC
CCAATTTATGACCTTTCAGACTGTATCAAGCGTAGGCAAGAAACAATCTTGGTGGATTACCCTGACCCA
AAAGAACTTTCTGCTGAAGAAATAGCTGAAAGAATGGGAATGATAGAAGAGGAAGAATCAGATCATTTG
GGTTGGGAAAGTCTGCCCACTGACCCCAGAGCCCAGGAAGATAATTCTGTTACCTCGTGTGATCCAAAG
CCAGAAACATGTTCCTGCTGTTTTCATGAAGACGAGGATCCTGCTGTCTTGGCAGAGAATGCTGGATTC
AGTGCAGATAGCTACCCTGAGCAAGAGGAAACCACCAAAGAAGAGTGGTCCCAAGACTTTAAAGATGAA
GGGTTGGGCATCAGCACCGATAAAGCATATACAGGCAGCATGCTGAGGAAGCGTAACCCCCAGGGTTTA
GAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001206671
Insert Size 1110 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001206671.2
RefSeq Size 5830 bp
RefSeq ORF 1110 bp
Locus ID 79608
UniProt ID Q7Z5B4
Protein Families Transmembrane
MW 41.1 kDa
Gene Summary This gene encodes a member of the resistance to inhibitors of cholinesterase 3-like family which functions as a chaperone of specific 5-hydroxytryptamine type 3 receptor and nicotinic acetylcholine receptor subtypes. The encoded protein influences the folding and assembly of these receptor subunits in the endoplasmic reticulum and expression on the cell surface. This protein contains an N-terminal transmembrane domain, a proline-rich spacer, and a cytosolic C-terminal coiled-coil domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the coding region, compared to variant 1. The encoded isoform (a) is longer than isoform c. The isoform designation was changed from 'c' to 'a' to be consistent with isoforms cited in PMID 18691158. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...